Skip to Content
Merck
All Photos(1)

Documents

EHU064581

Sigma-Aldrich

MISSION® esiRNA

targeting human ALKBH3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAGACCTGGAAGAACAAAGAGCATCATCTCTCTGACAGAGAGTTTGTGTTCAAAGAACCTCAGCAGGTAGTACGTAGAGCTCCTGAGCCACGAGTGATTGACAGAGAGGGTGTGTATGAAATCAGCCTGTCACCCACAGGTGTATCTAGGGTCTGTTTGTATCCTGGCTTTGTTGACGTGAAAGAAGCTGACTGGATATTGGAACAGCTTTGTCAAGATGTTCCCTGGAAACAGAGGACTGGCATCAGAGAGGATATAACTTATCAGCAACCAAGACTTACAGCATGGTATGGAGAACTTCCTTACACTTATTCAAGAATCACTATGGAACCAAATCCTCACTGGCACCCTGTGCTGCGCACACTAAAGAACCGCATTGAAGAGAACACTGGCCACACCTTCAACTCCTTACTCTGCAATCTTTATCGCAATGAGAAGGACAGCGTGGACTGGCACAGTGATGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yuko Ueda et al.
Scientific reports, 7, 42271-42271 (2017-02-17)
The mammalian AlkB homolog (ALKBH) family of proteins possess a 2-oxoglutarate- and Fe(II)-dependent oxygenase domain. A similar domain in the Escherichia coli AlkB protein catalyzes the oxidative demethylation of 1-methyladenine (1-meA) and 3-methylcytosine (3-meC) in both DNA and RNA. AlkB
Thai Q Tran et al.
PLoS biology, 15(11), e2002810-e2002810 (2017-11-07)
Driven by oncogenic signaling, glutamine addiction exhibited by cancer cells often leads to severe glutamine depletion in solid tumors. Despite this nutritional environment that tumor cells often experience, the effect of glutamine deficiency on cellular responses to DNA damage and
Kiyohiko Hotta et al.
Oncology reports, 34(2), 648-654 (2015-06-03)
Prostate cancer antigen-1 (PCA-1)/ALKBH3 has been recently identified in human prostate cancer and its expression is correlated with disease progression and prognosis. However, the precise role and function of PCA-1/ALKBH3 in human malignancies are largely unknown. In the present study

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service