Skip to Content
Merck
All Photos(1)

Documents

EHU064451

Sigma-Aldrich

MISSION® esiRNA

targeting human MTMR14

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGACACGCATCTTTTTGATAAGGTCAGAGGCTATGACATCAAGCTGCTTCGATACCTGTCAGTCAAATACATCTGTGACCTGATGGTGGAGAACAAGAAGGTGAAGTTTGGCATGAATGTAACCTCCTCTGAGAAGGTGGACAAAGCCCAGCGCTATGCCGACTTCACTCTCCTCTCCATCCCGTATCCAGGCTGTGAATTTTTCAAGGAATATAAAGATCGGGATTACATGGCAGAAGGGCTCATATTTAACTGGAAGCAGGACTACGTTGATGCCCCATTGAGCATCCCCGACTTCCTGACTCACTCTCTGAACATTGACTGGAGCCAGTATCAGTGTTGGGATCTGGTGCAACAAACACAAAACTACCTGAAGCTGCTGCTTTCCTTAGTTAACAGTGATGATGACAGCGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhaodong Li et al.
Gene, 691, 106-113 (2018-12-27)
Myotubularin-related protein 14 (MTMR14) is a member of the myotubularin (MTM)-related protein family and plays a key role in cardiomyopathy and autophagy. However, its potential implication in human cancer is unclear. In this study, we have investigated the expression profile
Qichen Pan et al.
Biochemical and biophysical research communications, 529(4), 1045-1052 (2020-08-21)
The phosphoinositide phosphatase, myotubularinrelated protein 14 (MTMR14), plays a critical role in the regulating autophagy. However, its functional contribution to neuronal autophagy is still unclear. In the present study, we attempted to explore the effects of MTMR14 on ischemic stroke
Jie-Lei Zhang et al.
Cell death & disease, 11(2), 140-140 (2020-02-23)
Cardiac hypertrophy (CH) is an independent risk factor for many cardiovascular diseases, and is one of the primary causes of morbidity and mortality in elderly people. Pathological CH involves excessive protein synthesis, increased cardiomyocyte size, and ultimately the development of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service