Skip to Content
Merck
All Photos(1)

Key Documents

EHU059131

Sigma-Aldrich

MISSION® esiRNA

targeting human GLB1 (2)

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGCTCTGCGAAACATCATCCAGAAGTTTGAAAAAGTACCAGAAGGTCCTATCCCTCCATCTACACCAAAGTTTGCATATGGAAAGGTCACTTTGGAAAAGTTAAAGACAGTGGGAGCAGCTCTGGACATTCTGTGTCCCTCTGGGCCCATCAAAAGCCTTTATCCCTTGACATTTATCCAGGTGAAACAGCATTATGGGTTTGTGCTGTACCGGACAACACTTCCTCAAGATTGCAGCAACCCAGCACCTCTCTCTTCACCCCTCAATGGAGTCCACGATCGAGCATATGTTGCTGTGGATGGGATCCCCCAGGGAGTCCTTGAGCGAAACAATGTGATCACTCTGAACATAACAGGGAAAGCTGGAGCCACTCTGGACCTTCTGGTAGAGAACATGGGACGTGTGAACTATGGTGCATATATCAACGATTTTAAGGGTTTGGTTTCTAACCTGACTCTCAGTTCCAATATCCTCACGGACTGGACGATCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Konrad A Szychowski et al.
Neurotoxicity research, 36(3), 503-514 (2019-06-05)
Throughout the lifetime of humans, the amount of stem cells and the rate of cell proliferation continue to decrease. Reactive oxygen species (ROS) are one among the many factors that promote stem cell aging. Both a decrease in the level
Hongmei Shen et al.
Nature communications, 11(1), 2979-2979 (2020-06-14)
NMDA receptor-dependent long-term depression (NMDAR-LTD) is a long-lasting form of synaptic plasticity. Its expression is mediated by the removal of AMPA receptors from postsynaptic membranes. Under basal conditions, endocytosed AMPA receptors are rapidly recycled back to the plasma membrane. In

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service