Skip to Content
Merck
All Photos(1)

Key Documents

EHU051661

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGB3, RP11-290H9.2

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€197.00
50 μG
€349.00

€197.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)


Select a Size

Change View
20 μG
€197.00
50 μG
€349.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€197.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGCATTGTCCAGCCTAATGACGGGCAGTGTCATGTTGGTAGTGACAATCATTACTCTGCCTCCACTACCATGGATTATCCCTCTTTGGGGCTGATGACTGAGAAGCTATCCCAGAAAAACATCAATTTGATCTTTGCAGTGACTGAAAATGTAGTCAATCTCTATCAGAACTATAGTGAGCTCATCCCAGGGACCACAGTTGGGGTTCTGTCCATGGATTCCAGCAATGTCCTCCAGCTCATTGTTGATGCTTATGGGAAAATCCGTTCTAAAGTAGAGCTGGAAGTGCGTGACCTCCCTGAAGAGTTGTCTCTATCCTTCAATGCCACCTGCCTCAACAATGAGGTCATCCCTGGCCTCAAGTCTTGTATGGGACTCAAGATTGGAGACACGGTGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jing Wu et al.
Journal of cellular physiology, 235(11), 8679-8690 (2020-04-24)
Tumor-associated microglial cells promote glioma growth, invasion, and chemoresistance by releasing inflammatory factors. Milk fat globule EGF factor 8 protein (MFG-E8), a secreted glycoprotein, is closely related to tissue homeostasis and anti-inflammation. In the present study, we investigated the role
Francesco Baschieri et al.
Nature communications, 9(1), 3825-3825 (2018-09-22)
It is generally assumed that cells interrogate the mechanical properties of their environment by pushing and pulling on the extracellular matrix (ECM). For instance, acto-myosin-dependent contraction forces exerted at focal adhesions (FAs) allow the cell to actively probe substrate elasticity.
Hanan S Elsarraj et al.
NPJ breast cancer, 6, 12-12 (2020-05-01)
The molecular processes by which some human ductal carcinoma in situ (DCIS) lesions advance to the more aggressive form, while others remain indolent, are largely unknown. Experiments utilizing a patient-derived (PDX) DCIS Mouse INtraDuctal (MIND) animal model combined with ChIP-exo

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service