Skip to Content
Merck
All Photos(1)

Key Documents

EHU051601

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€197.00
50 μG
€349.00

€197.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)


Select a Size

Change View
20 μG
€197.00
50 μG
€349.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€197.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACAATCGTGTGGGTGAAGCGTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGTTTCACTGATCCTTCCAACAATAAGAACCGTTTCTGCCTTGGGCTGCTCTCCAATGTTAACCGGAATTCCACTATTGAAAACACCAGGCGGCATATTGGAAAAGGAGTTCATCTTTATTATGTTGGAGGGGAGGTGTATGCCGAATGCCTTAGTGACAGTAGCATCTTTGTGCAAAGTCGGAACTGCAACTACCATCATGGATTTCATCCTACTACTGTTTGCAAGATCCCTAGTGGGTGTAGTCTGAAAATTTTTAACAACCAAGAATTTGCTCAGTTATTGGCACAGTCTGTGAACCATGGATTTGAGACAGTCTATGAGCTTACAAAAATGTGTACTATACGTATGAGCTTTGTGAAGGGCTGGGGAGCAGAATACCACCGCCAGGATGTTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bo Ram Kim et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(12), 9475-9486 (2015-07-01)
Bone morphogenetic proteins (BMPs) have been involved in metastatic progression and tumorigenesis of many cancer types. However, it remains unclear how BMP-2 contributes to the initiation and development of these cancers. Here, we investigated the role of BMP-2 in colon
Dawid Wnuk et al.
Scientific reports, 10(1), 16492-16492 (2020-10-07)
Airway remodelling with subepithelial fibrosis, which abolishes the physiological functions of the bronchial wall, is a major issue in bronchial asthma. Human bronchial fibroblasts (HBFs) derived from patients diagnosed with asthma display in vitro predestination towards TGF-β1-induced fibroblast-to-myofibroblast transition (FMT)
X Su et al.
Cell death & disease, 6, e1851-e1851 (2015-08-08)
MicroRNAs (miRNAs) emerge as important regulators of stem cell lineage commitment and bone development. MiRNA-26a (miR-26a) is one of the important miRNAs regulating osteogenic differentiation of both bone marrow-derived mesenchymal stem cells (BMSCs) and adipose tissue-derived mesenchymal stem cells (ADSCs).

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service