Skip to Content
Merck
All Photos(1)

Key Documents

EHU008031

Sigma-Aldrich

MISSION® esiRNA

targeting human EAF2

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€197.00
50 μG
€349.00

€197.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
€197.00
50 μG
€349.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€197.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAAACAAGAGTTGAAGGAAGCAGTAAAATTCAGTATCGTAAAGAACAACAGCAACAACAAATGTGGAATTCAGCCAGGACTCCCAATCTTGTAAAACATTCTCCATCTGAAGATAAGATGTCCCCAGCATCTCCAATAGATGATATCGAAAGAGAACTGAAGGCAGAAGCTAGTCTAATGGACCAGATGAGTAGTTGTGATAGTTCATCAGATTCCAAAAGTTCATCATCTTCAAGTAGTGAGGATAGTTCTAGTGACTCAGAAGATGAAGATTGCAAATCCTCTACTTCTGATACAGGGAATTGTGTCTCAGGACATCCTACCATGACACAGTACAGGATTCCTGATATAGATGCCAGTCATAATAGATTTCGAGACAACAGTGGCCTTCTGATGAATACTTTAAGAAATGATTTGCAGCTGAGTGAATCAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenhuan Guo et al.
The Prostate, 75(9), 976-987 (2015-03-27)
ELL-associated factor 2 (EAF2) is an androgen-regulated tumor suppressor in the prostate. However, the mechanisms underlying tumor suppressive function of EAF2 are still largely unknown. Identification of factors capable of modulating EAF2 function will help elucidate the mechanisms underlying EAF2
Liquan Cai et al.
Biochemical and biophysical research communications, 447(2), 292-298 (2014-04-15)
The tumor suppressor EAF2 is regulated by androgen signaling and associated with prostate cancer. While EAF2 and its partner ELL have been shown to be members of protein complexes involved in RNA polymerase II transcriptional elongation, the biologic roles for

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service