Direkt zum Inhalt
Merck

EHU138481

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX11

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGATGTTCGACCTGAGCTTGAATTTCTCTCAAAGCGCGCACAGCGCCAGCGAGCAGCAGCTGGGGGGCGGCGCGGCGGCCGGGAACCTGTCCCTGTCGCTGGTGGATAAGGATTTGGATTCGTTCAGCGAGGGCAGCCTGGGCTCCCACTTCGAGTTCCCCGACTACTGCACGCCGGAGCTGAGCGAGATGATCGCGGGGGACTGGCTGGAGGCGAACTTCTCCGACCTGGTGTTCACATATTGAAAGGCGCCCGCTGCTCGCTCTTTCTCTCGGAGGGTGCAGAGCTGGGTTCCTTGGGAGGAAGTTGTAGTGGTGATGATGATGATGATAATGATGATGATGATGGTGGTGTTGATGGTGGCGGTGGTAGGGTGGAGGGGAGAGAAGAAGATGCTGATGATATTGATAAGATGTCGTGACGCAAAGAAA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lei Chang et al.
American journal of cancer research, 7(11), 2305-2317 (2017-12-09)
To explore the functions of
Feng Xue et al.
Oncology letters, 21(4), 255-255 (2021-03-06)
The dysregulation of lncRNA TMPO antisense RNA 1 (TMPO-AS1) has been detected in various malignant tumors. However, the role of lncRNA TMPO-AS1 remains unclear in pancreatic carcinoma. The present study aimed to elucidate the functional mechanism of TMPO-AS1 in pancreatic
Mingxing Fang et al.
International journal of molecular medicine, 47(1), 361-373 (2020-11-26)
The aim of the present study was to explore the potential role of SOX11 in the stretch‑induced mechanical injury to alveolar type 2 epithelial (AT2) cells. A cell stretch (CS) test was used to induce mechanical injury to primary cultured AT2 cells. Wound
Atish Mohanty et al.
Blood, 133(4), 306-318 (2018-12-12)
The neural transcription factor SOX11 is usually highly expressed in typical mantle cell lymphoma (MCL), but it is absent in the more indolent form of MCL. Despite being an important diagnostic marker for this hard-to-treat malignancy, the mechanisms of aberrant
Chao Chen et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(29), 10629-10642 (2015-07-24)
As the cerebral cortex forms, specialized molecular cascades direct the expansion of progenitor pools, the differentiation of neurons, or the maturation of discrete neuronal subtypes, together ensuring that the correct amounts and classes of neurons are generated. In several neural

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.