Anmelden zur Ansicht der Organisations- und Vertragspreise.
Größe auswählen
Ansicht ändern
Über diesen Artikel
NACRES:
NA.51
UNSPSC Code:
41105324
Technischer Dienst
Benötigen Sie Hilfe? Unser Team von erfahrenen Wissenschaftlern ist für Sie da.
Unterstützung erhaltendescription
Powered by Eupheria Biotech
Quality Segment
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAGCACAGACAGCACTTCCATATGCCATGAATAGCGAGTTCTCAAGTGTCTTAGCTGCACAGCTGAAGCATCACTCTGAGAATAAGGGCCTAGACAAAGTGATGGAGACTCAAGCCCAAGTGGATGAACTGAAAGGAATCATGGTCAGAAACATAGATCTGGTAGCTCAGCGAGGAGAAAGATTGGAATTATTGATTGACAAAACAGAAAATCTTGTGGATTCTTCTGTCACCTTCAAAACTACCAGCAGAAATCTTGCTCGAGCCATGTGTATGAAGAACCTCAAGCTCACTATTATCATCATCATCGTATCAATTGTGTTCATCTATATCATTGTTTCACCTCTCTGTGGTGGATTTACATGGCCAAGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... VAMP7(6845)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Biochem/physiol Actions
VAMP7 (vesicle-associated membrane protein 7) is mainly involved with granule trafficking and secretion. It is a platelet VAMP isoform, which is associated with fusion processes during membrane remodeling. It is responsible for neurite outgrowth, lysosome secretion during cell movement, vesicular transport to the apical membrane in epithelial cells, autophagosome biogenesis, release of autophagic vesicles, heterotypic fusion of late endosomes with lysosomes and homotypic lysosomal fusion. VAMP7 is also involved with the fusion of trans-Golgi network-derived lysosome-linked membrane protein carriers with late endosomes. Increase in the gene copy number of VAMP7 causes alteration in estrogen receptor action, thereby disrupting male urogenital development.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Lagerklasse
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Hier finden Sie alle aktuellen Versionen:
Besitzen Sie dieses Produkt bereits?
In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.