Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU093271

Sigma-Aldrich

MISSION® esiRNA

targeting human VAMP7 (2)

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GAGCACAGACAGCACTTCCATATGCCATGAATAGCGAGTTCTCAAGTGTCTTAGCTGCACAGCTGAAGCATCACTCTGAGAATAAGGGCCTAGACAAAGTGATGGAGACTCAAGCCCAAGTGGATGAACTGAAAGGAATCATGGTCAGAAACATAGATCTGGTAGCTCAGCGAGGAGAAAGATTGGAATTATTGATTGACAAAACAGAAAATCTTGTGGATTCTTCTGTCACCTTCAAAACTACCAGCAGAAATCTTGCTCGAGCCATGTGTATGAAGAACCTCAAGCTCACTATTATCATCATCATCGTATCAATTGTGTTCATCTATATCATTGTTTCACCTCTCTGTGGTGGATTTACATGGCCAAGC

Ensembl | Human Hinterlegungsnummer

ENSG00000124333

NCBI-Hinterlegungsnummer

NM_005638

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... VAMP7(6845) , VAMP7(6845)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem./physiol. Wirkung

VAMP7 (vesicle-associated membrane protein 7) is mainly involved with granule trafficking and secretion. It is a platelet VAMP isoform, which is associated with fusion processes during membrane remodeling. It is responsible for neurite outgrowth, lysosome secretion during cell movement, vesicular transport to the apical membrane in epithelial cells, autophagosome biogenesis, release of autophagic vesicles, heterotypic fusion of late endosomes with lysosomes and homotypic lysosomal fusion. VAMP7 is also involved with the fusion of trans-Golgi network-derived lysosome-linked membrane protein carriers with late endosomes. Increase in the gene copy number of VAMP7 causes alteration in estrogen receptor action, thereby disrupting male urogenital development.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Increased gene copy number of VAMP7 disrupts human male urogenital development through altered estrogen action.
Tannour-Louet M
Nature Medicine, 20, 715-715 (2014)
hVps41 and VAMP7 function in direct TGN to late endosome transport of lysosomal membrane proteins.
Pols MS
Nature Communications, 4, 1361-1361 (2013)
Laure-Anne Ligeon et al.
Autophagy, 10(9), 1588-1602 (2014-07-22)
Yersinia pseudotuberculosis can replicate inside macrophages by hijacking autophagy and blocking autophagosome acidification. In bone marrow-derived macrophages, the bacteria are mainly observed inside double-membrane vacuoles positive for LC3, a hallmark of autophagy. Here, we address the question of the membrane
Secil Koseoglu et al.
Blood, 126(5), 651-660 (2015-05-23)
Platelet activation results in profound morphologic changes accompanied by release of granule contents. Recent evidence indicates that fusion of granules with the plasma membrane during activation provides auxiliary membrane to cover growing actin structures. Yet little is known about how
Riddhi Atul Jani et al.
Journal of cell science, 128(17), 3263-3276 (2015-07-26)
Melanosomes are a class of lysosome-related organelles produced by melanocytes. Biogenesis of melanosomes requires the transport of melanin-synthesizing enzymes from tubular recycling endosomes to maturing melanosomes. The SNARE proteins involved in these transport or fusion steps have been poorly studied.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.