Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU137641

Sigma-Aldrich

MISSION® esiRNA

targeting human ARF6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGAGGCTTCGTTTCGGTTTCGCGGCGGCGGCGGCGTTGTTGGCTGAGGGGACCCGGGACACCTGAATGCCCCCGGCCCCGGCTCCTCCGACGCGATGGGGAAGGTGCTATCCAAAATCTTCGGGAACAAGGAAATGCGGATCCTCATGTTGGGCCTGGACGCGGCCGGCAAGACAACAATCCTGTACAAGTTGAAGCTGGGCCAGTCGGTGACCACCATTCCCACTGTGGGTTTCAACGTGGAGACGGTGACTTACAAAAATGTCAAGTTCAACGTATGGGATGTGGGCGGCCAGGACAAGATCCGGCCGCTCTGGCGGCATTACTACACTGGGACCCAAGGTCTCATCTTCGTAGTGGACTGCGCCGACCGCGACCGCATCGATGAGGCTCGCCAGGAGCTGCACCGCATTATCAATGACCGGGAGATGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yujie Zhang et al.
Oncotarget, 6(9), 7244-7261 (2015-03-18)
Wnt5a, a ligand for activating the non-canonical Wnt signaling pathway, is commonly associated with Epithelial-to-mesenchymal transition (EMT) in cancer cell metastasis. Here, we show that downregulation of Wnt5a mRNA and protein by EGF is necessary for EGF-induced EMT in gastric
Jouda Gamara et al.
Mediators of inflammation, 2020, 2713074-2713074 (2020-04-24)
Chemoattractant sensing, adhesiveness, and migration are critical events underlying the recruitment of neutrophils (PMNs) to sites of inflammation or infection. Defects in leukocyte adhesion or migration result in immunodeficiency disorders characterized by recurrent infections. In this study, we evaluated the
Yueh-Chien Lin et al.
Scientific reports, 7(1), 11431-11431 (2017-09-14)
The small GTPase Arf6 plays pivotal roles in a wide variety of cellular events such as endocytosis, exocytosis, and actin cytoskeleton reorganization. However, the physiological functions of Arf6 at the whole animal level have not yet been thoroughly understood. Here
Mohamed Bourmoum et al.
Journal of cell science, 131(11) (2018-05-05)
Sister chromatid cohesion, facilitated by the cohesin protein complex, is crucial for the establishment of stable bipolar attachments of chromosomes to the spindle microtubules and their faithful segregation. Here, we demonstrate that the GTPase ARF6 prevents the premature loss of
Vahitha B Abdul-Salam et al.
Circulation research, 124(1), 52-65 (2018-12-26)
Increased expression of CLIC4 (chloride intracellular channel 4) is a feature of endothelial dysfunction in pulmonary arterial hypertension, but its role in disease pathology is not fully understood. To identify CLIC4 effectors and evaluate strategies targeting CLIC4 signaling in pulmonary

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service