Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU095021

Sigma-Aldrich

MISSION® esiRNA

targeting human NELL1 (1)

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGCCGTGCATTTAAGTCAATGGTTGTTAAAAGAAGTTTCCCGTGTTGTAAATCATGTTTCCCTTATCAGATCATTTGCAAATACATTTAAATGATCTCATGGTAAATGTTGATGTATTTTTTGGTTTATTTTGTGTACTAACATAATAGAGAGAGACTCAGCTCCTTTTATTTATTTTGTTGATTTATGGATCAAATTCTAAAATAAAGTTGCCTGTTGTGACTTTTGTCCCATCTACTGCATACTTAGTGCTGAGATCCCTGTAAAATGTTTTGATGAAAATATGTATGTAGAGTCCAGTCGCATTATACATACATTTCATAGTGCTGAACCTTCTTAAATGCC

Ensembl | human accession no.

ENSG00000165973

NCBI accession no.

NM_006157

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NELL1(4745) , NELL1(4745)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Juan Cong Dong et al.
Journal of cellular and molecular medicine, 19(9), 2286-2295 (2015-07-07)
The purpose of this study was to determine the correlation between over-expression of the neuropilin 1 (NRP1) gene and growth, survival, and radio-sensitivity of non-small cell lung carcinoma (NSCLC) cells. 3-[4,5-dimethylthylthiazol-2-yl]-2,5 diphenyltetrazolium broide (MTT) and colony assays were then performed
Anthony Ambesi et al.
Journal of cell science, 127(Pt 17), 3805-3816 (2014-07-02)
The fibronectin matrix plays a crucial role in the regulation of angiogenesis during development, tissue repair and pathogenesis. Previous work has identified a fibronectin-derived homophilic binding peptide, anastellin, as an effective inhibitor of angiogenesis; however, its mechanism of action is
Claudio Raimondi et al.
The Journal of experimental medicine, 211(6), 1167-1183 (2014-05-28)
To enable new blood vessel growth, endothelial cells (ECs) express neuropilin 1 (NRP1), and NRP1 associates with the receptor tyrosine kinase VEGFR2 after binding the vascular endothelial growth factor A (VEGF) to enhance arteriogenesis. We report that NRP1 contributes to
Hong-Bo Pang et al.
Nature communications, 5, 4904-4904 (2014-10-04)
Neuropilins (NRPs) are trans-membrane receptors involved in axon guidance and vascular development. Many growth factors and other signalling molecules bind to NRPs through a carboxy (C)-terminal, basic sequence motif (C-end Rule or CendR motif). Peptides with this motif (CendR peptides)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service