Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU023471

Sigma-Aldrich

MISSION® esiRNA

targeting human NT5E

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGAAGGTTCCTGTAGTCCAGGCCTATGCTTTTGGCAAATACCTAGGCTATCTGAAGATCGAGTTTGATGAAAGAGGAAACGTCATCTCTTCCCATGGAAATCCCATTCTTCTAAACAGCAGCATTCCTGAAGATCCAAGCATAAAAGCAGACATTAACAAATGGAGGATAAAATTGGATAATTATTCTACCCAGGAATTAGGGAAAACAATTGTCTATCTGGATGGCTCCTCTCAATCATGCCGCTTTAGAGAATGCAACATGGGCAACCTGATTTGTGATGCAATGATTAACAACAACCTGAGACACACGGATGAAATGTTCTGGAACCACGTATCCATGTGCATTTTAAATGGAGGTGGTATCCGGTCGCCCATTGATGAACGCAACAATGGCACAATTACCTGGGAGAACCTGGCTGCTGTATTGCCCTTTGGAGGCACATTTGACCTAGTCCAGTTAAAAGGTTCCACCCTGAAGAAGGCCTTTGAGCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Young Mun Jeong et al.
Cancers, 12(10) (2020-10-23)
CD73 is involved in tumor immune escape and promotes the growth and progression of cancer cells. The functional role of CD73 expression in papillary thyroid carcinoma (PTC) has not yet been established. In 511 patients with PTC, immunohistochemistry for CD73
Jaden S Lee et al.
Virulence, 11(1), 414-429 (2020-05-19)
Cell surface nucleotide-metabolizing enzyme, ectonucleotidase-CD73, has emerged as a central component of the cellular homeostatic-machinery that counterbalances the danger-molecule (extracellular-ATP)-driven proinflammatory response in immune cells. While the importance of CD73 in microbial host fitness and symbiosis is gradually being unraveled
Brett Verstak et al.
Journal of leukocyte biology, 96(3), 427-436 (2014-05-09)
TLRs act as sentinels in professional immune cells to detect and initiate the innate immune response to pathogen challenge. TLR4 is a widely expressed TLR, responsible for initiating potent immune responses to LPS. TRAM acts to bridge TLR4 with TRIF
Gina Lisignoli et al.
Tissue engineering. Part A, 20(19-20), 2795-2805 (2014-04-10)
The use of short interfering RNA (siRNA) in combination with stem cells and biocompatible scaffolds is a promising strategy in regenerative medicine. Our experimental strategy was to explore the possibility of forcing or guiding the chondrogenic differentiation of human mesenchymal
Xiao-Yu Shi et al.
Asian Pacific journal of tropical medicine, 7(10), 787-791 (2014-08-19)
To explore the effect of Fibulin-5 expression on cell proliferation and invasion in human gastric cancer patients. Fibulin-5 expression was detected in 56 samples of surgically resected gastric cancer and paired noncancerous tissues using qRT-PCR and immunoblotting. Fibulin-5 was knocked

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service