HLMIR1814
MISSION® Lenti microRNA, Human
hsa-miR-4753-5p
Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
About This Item
Código UNSPSC:
41106609
NACRES:
NA.51
Nivel de calidad
Línea del producto
MISSION®
Formulario
liquid
concentración
≥1x106 VP/ml (via p24 assay)
secuencia madura
CAAGGCCAAAGGAAGAGAACAG
Nº de acceso Sanger mature/minor
Nº de acceso Sanger microRNA
Condiciones de envío
dry ice
temp. de almacenamiento
−70°C
Descripción general
Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.
Otras notas
Based on miRBase V20 Mature ID
Productos recomendados
Two negative controls are available: NCLMIR001 and NCLMIR002
Información legal
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
control
Referencia del producto
Descripción
Precios
Código de clase de almacenamiento
12 - Non Combustible Liquids
Clase de riesgo para el agua (WGK)
WGK 3
Punto de inflamabilidad (°F)
Not applicable
Punto de inflamabilidad (°C)
Not applicable
Elija entre una de las versiones más recientes:
Certificados de análisis (COA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.
Si necesita más asistencia, póngase en contacto con Atención al cliente
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.
Póngase en contacto con el Servicio técnico