Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU183631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mki67

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACTTCAGAGACACAGGCAAGAAGAAGACTCAGGAGACTGGTTGTTACTGAAGAGCCCATACCACAAAGAAAGACTACAAGAGTTGTAAGGCAAACCAGAAACACACAGAAAGAGCCCATAAGTGACAATCAAGGTATGGAAGAGTTTAAGGAATCTTCAGTACAGAAACAAGACCCAAGTGTAAGTTTAACTGGCAGGAGGAACCAACCAAGGACAGTTAAGGAGAAAACCCAACCCTTAGAAGAACTCACCAGTTTCCAAGAGGAAACTGCCAAAAGAATATCTTCCAAATCTCCACAACCGGAAGAGAAGGAAACCTTAGCAGGTTTAAAGAGGCAGCTCAGAATACAACTAATCAACGATGGTGTAAAAGAAGAGCCCACAGCACAGAGAAAGCAACCATCCAGGGAAACCAGGAACACACTCAAAGAGCCTGTAGGTGACAGTATAAATGTTGAAGAGGTTAAGAAGTCTACAAAGCAGAAAATTGATCCAGTAGCAAGTGTGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xu Zhou et al.
Scientific reports, 5, 10071-10071 (2015-05-12)
Cancer neovascularization plays an essential role in the metastasis of larynx carcinoma (LC). However, the underlying molecular mechanisms are not completely understood. Recently, we reported that placental growth factor (PLGF) regulates expression of matrix metalloproteinase 3 (MMP3) through ERK/MAPK signaling
Kanako Tamura et al.
PloS one, 10(5), e0126003-e0126003 (2015-05-06)
Glucagon-like peptide-1 (GLP-1) receptor agonists potentiate glucose-induced insulin secretion. In addition, they have been reported to increase pancreatic beta cell mass in diabetic rodents. However, the precise mode of action of GLP-1 receptor agonists still needs to be elucidated. Here
David W Chapman et al.
EJNMMI research, 4(1), 27-27 (2015-06-28)
The multitargeting tyrosine kinase inhibitor (TKI) sunitinib is currently the first-line drug therapy for metastasizing renal cell carcinoma (RCC). TKIs have profound effects on tumor angiogenesis, leading to modifications of the tumor microenvironment. The goal of this study was to

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico