Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU149921

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Esrrg

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTGCTCTCTGTATTCTGTGGACAGTCTTATTCTATGTACACAGATGTAATTAAAGTTGTACTCCTAACAAACAAAAGAATAGTTCAGCTTCAATGTTCCATGTTTGCTGCGCTTTTCTGAACTTTATGTTGCATTCAGAAACTGTCGTCTTGTTCTCGTGGTGTTTGGATTCTTGTGGTGTGTGCTTTTAGACACAGGGTAGAATTAGAGACAGTATTGGATGTATACTTCCTCAGGAGACTACAGTAGTATATTCTACTCCTTACCAGTAATAACTAAGAGATTGAAACTCCAAAACAGTATTCATTACGATCAGACACACATCAAAATCATAATAATATTTTCAAAAAAGGGATAATTTCTCTAATGGTTTATTATAGAATACCAATGTATAGCTTAGACATAAAACTTTGAATATTCAAGAATATAGATAAGTCTAATTTTTAAATGCTGTATATAAGGCTTCCACCTGATCATCTCTCAGATGTTGTTATTAACTCGCTCTGTGT

Ensembl | nº de acceso | ratón

ENSMUSG00000026610

Nº de acceso NCBI

NM_011935

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... ESRRG(26381) , Esrrg(26381)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JFS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jiao Meng et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 11460-11473 (2021-01-08)
Lycium barbarum berry (gouqi, Goji, goji berry, or wolfberry), a traditional medicine and functional food, has a wide range of biological effects, including immuno-modulation, anti-aging, antitumor, neuro-protection, and hepato-protection. However, thus far, little is known about the traditional effects of
Bo Yuan et al.
Cancer science, 106(7), 819-824 (2015-05-06)
Hepatocellular carcinoma (HCC) is among the leading causes of cancer-related death in China. Deregulation of microRNA (miRNA) contributes to HCC development by influencing cell growth, apoptosis, migration or invasion. It has been proved that miR-940 plays important roles in various

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico