Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU095351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stmn1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACCCACAAAATGGAGGCTAACAAAGAGAACCGGGAGGCGCAGATGGCGGCCAAGCTGGAGCGCTTGCGAGAGAAGGACAAGCACGTGGAAGAGGTGCGGAAGAACAAAGAATCCAAAGACCCCGCGGATGAGACTGAGGCTGACTAAGTTGTCCCGAGAACTGACTTTCTCCCCGACCCCGTCCTAAATATCCAAAGACTGTACTGGCCAGTGTCCTTTACTTTCCCTCCTGACAGATAGTCTAGAAGCCGATGTAGGACCGTATAGGTAGATCCAGACCGTGAGATGTTTTAGGGGCTCAAGGGGAGAAACTGAAAGTGTTTTACTCTTTTTTAAAGTGTTGGTCTTTCTAATGTAGCTATTTTTCTCGTTGCATCTTTTCCACTCGGGCACAATCGGTGTGCTGGGTTAATGGCTAGTACTGTATTGACTGTGGAAGACGTTTGTGAAGAGTATGTAGTGGCTTCTTCCAACCCATTAGATGCTGAATATCTGTCCACTTTGCGATCCCAATTCT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Isioma I Enwerem et al.
PloS one, 10(4), e0122348-e0122348 (2015-04-16)
Small nuclear ribonucleoproteins (snRNPs), which are required for pre-mRNA splicing, contain extensively modified snRNA. Small Cajal body-specific ribonucleoproteins (scaRNPs) mediate these modifications. It is unknown how the box C/D class of scaRNPs localizes to Cajal Bodies (CBs). The processing of
W Feng et al.
Cancer gene therapy, 22(3), 115-121 (2015-01-13)
Paclitaxel (PTX) is broadly considered the drug of choice for treating human esophageal squamous cell cancer (ESCC). However, PTX resistance often ultimately leads to treatment failure. stathmin, or Op18, is a ubiquitously expressed 19-kDa cytosolic phosphoprotein that can integrate various
Kimberly A Birnie et al.
Molecular cancer research : MCR, 13(7), 1106-1118 (2015-04-01)
Malignant pleural mesothelioma (MPM) is often fatal, and studies have revealed that aberrant miRNAs contribute to MPM development and aggressiveness. Here, a screen of miRNAs identified reduced levels of miR-223 in MPM patient specimens. Interestingly, miR-223 targets Stathmin (STMN1), a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico