Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU074311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fermt2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCGGTTGTCCTTCATCTGTACCGAAGTAGACTGCAAGGTGGTCCACGAATTCATTGGTGGTTACATATTTCTCTCAACTCGTGCGAAAGACCAAAATGAAAGTTTAGATGAGGAGATGTTCTACAAACTCACCAGTGGTTGGGTGTGAATAGGAAAACTTGTAATAAAACTCCACAGCCATAACAATATTTAACTTTAAAGCTATTGTTTCTTATATGCTGCTTAATAAAGTAAGCTTGAACTTTATTATTTTATCATGATACCTTTTTGCCTTACCAGACCAGTACATATGTGCACTAACAAGCACGATTGTTAATCTGCTGCCTACCTTGATATGCCGTATGTGGACTGTGGAATTCCCAACAGTCCTTAGGGCCACGGAAAGCTGTCACTGACTGACAGTAACCAAACTAAGAAACAAGCCATCTACCAAGCCAC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hai-Feng Zhang et al.
Oncotarget, 6(30), 28949-28960 (2015-09-04)
Our previous studies have shown that loss of miR-200b enhances the invasiveness of esophageal squamous cell carcinoma (ESCC) cells. However, whether the miR-200-ZEB1/2-E-cadherin regulatory cascade, a master regulator of epithelial-to-mesenchymal transition (EMT), is involved in the regulation of ESCC invasion
Yu Yu et al.
PloS one, 8(5), e63490-e63490 (2013-05-30)
Kindlin 2, as an integrin-associated protein, is required for myocyte elongation and fusion. However, the association of Kindlin 2 with muscle differentiation-related signaling pathways is unknown. Here, we identified a mechanism that Kindlin 2 regulates myogenic regulatory factors myogenin via
Zhaoli Liu et al.
FEBS letters, 589(15), 2001-2010 (2015-06-04)
Kindlin-2 regulates external to internal cell signaling by interaction with integrins in a process that involves the tyrosine kinase, Src. However, the underlying mechanisms remain elusive. Here we report that Src binds to and phosphorylates Kindlin-2 at Y193. Reciprocally, Kindlin-2-Y193

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico