Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU073651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fcgr3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACACAGCACCAGTCCAAGCCTGTCACCATCACTGTCCAAGATCCAGCAACTACATCCTCCATCTCTCTAGTCTGGTACCACACTGCTTTCTCCCTAGTGATGTGCCTCCTGTTTGCAGTGGACACGGGCCTTTATTTCTACGTACGGAGAAATCTTCAAACCCCGAGGGAGTACTGGAGGAAGTCCCTGTCAATCAGAAAGCACCAGGCTCCTCAAGACAAGTGACACCCCATCCATCCTATGGCAAAACATACGATGTTTTGGTGGCAGCAGCAACTTTTCAGCCACACAGCCTTCCTTTGAAAGCAACTTACAAGCAGGCCGGGATGTTTGGTTCTTCAATCACAACGACTTAGGATCACCAGTTCAAGGCTTGCTGGGTCACACAGAGAGAGTGAGTGCAAGTCTAGCCTGGATAACCCAGTGAGATCCTGGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... Fcgr3(14131)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Martina Schmittnaegel et al.
Cancer immunology research, 3(7), 764-776 (2015-02-19)
Tumor cells escape immune eradication through multiple mechanisms, including loss of antigenicity and local suppression of effector lymphocytes. To counteract these obstacles, we aimed to direct the unique cytomegalovirus (CMV)-specific immune surveillance against tumor cells. We developed a novel generation
Siva K Gandhapudi et al.
Journal of immunology (Baltimore, Md. : 1950), 194(8), 3820-3828 (2015-03-18)
Although IL-18 has not previously been shown to promote T lymphopoiesis, results obtained via a novel data mining algorithm (global microarray meta-analysis) led us to explore a predicted role for this cytokine in T cell development. IL-18 is a member
Wai W Lin et al.
Science signaling, 8(392), ra88-ra88 (2015-09-04)
Tumor necrosis factor receptor-associated factor 3 (TRAF3) is an adaptor protein that inhibits signaling by CD40 and by the receptor for B cell-activating factor (BAFF) and negatively regulates homeostatic B cell survival. Loss-of-function mutations in TRAF3 are associated with human

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico