Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU065851

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Skp2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTCCTCGGCTGCAGATTAACTGCGCCTATTTCACCACCATTGCAAGGCCAACTATGGACAGCAAGAAGAACCTGGAGATTTGGGGTATCAAGTGCCGACTGACTCTGCAAAAGCCCAGTTGTCTATGAAGTGCTTACCGCAGAGCGGTGTTTCCTCTGGAACGAGGAAAGCAGGCAGCAAGTCCGCATGCTGGAGACCTTGGTTACTCTTCCTATTGGCTTTGCCTTAGCCTTCACTTTATATGTATGTTAGGGAACCATTTGCGAGGGGGACAGCCACGAAGTGTTACTTTTTCAAAACTATAGAGCCGATTCTGTCAGTGCTGTGCCCTAAGGGCCTAAGCGGCAGGTCTTTGGAGATTTTAGGAGAGCCTATGATTTCAGCATGCTTTTTTAAAAGCGACATTTGAGCCAAC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Haijin Chen et al.
Molecular medicine reports, 10(2), 1129-1135 (2014-06-11)
Colon cancer is a common type of malignancy in the digestive system. The aim of the present study was to investigate the role of S-phase kinase-associated protein 2 (Skp2) in colon carcinoma and to identify whether depletion of Skp2 by Skp2‑RNA interference
Ming Qi et al.
Molecular medicine reports, 11(5), 3934-3940 (2015-01-13)
In order to determine the protein expression of S‑phase kinase‑associated protein 2 (Skp2) and p27kip1, and to evaluate their possible prognostic values in malignant liver cancer, tissue samples from 50 patients and 40 controls were assessed and analyzed by immunohistochemistry
Wenfu Lu et al.
Oncotarget, 6(2), 771-788 (2015-01-19)
Aberrant elevation of JARID1B and histone H3 lysine 4 trimethylation (H3K4me3) is frequently observed in many diseases including prostate cancer (PCa), yet the mechanisms on the regulation of JARID1B and H3K4me3 through epigenetic alterations still remain poorly understood. Here we

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico