Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU061231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sp1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATCAGTTCTGCCAGCTTGGTGTCATCACAAGCTAGTTCCAGCTCCTTTTTCACCAATGCCAATAGTTATTCAACAACTACTACCACCAGCAACATGGGAATTATGAACTTTACCAGCAGTGGTTCATCAGGGACTAGTTCTCAAGGCCAGACGCCCCAGAGGGTTGGTGGGCTACAAGGGTCTGATTCTCTGAACATCCAGCAGAACCAGACATCAGGAGGCTCGCTGCAAGGAAGTCAGCAGAAAGAGGGAGAGCAAAGTCAGCAGACACAGCAACAACAAATTCTTATTCAGCCTCAGCTAGTTCAAGGAGGACAAGCTCTTCAGGCCCTTCAAGCAGCACCATTGTCCGGACAGACCTTCACAACTCAAGCTATTTCCCAGGAAACCCTTCAGAACCTCC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kazuo Asanoma et al.
Molecular and cellular biology, 35(24), 4096-4109 (2015-09-24)
BHLHE40 and BHLHE41 (BHLHE40/41) are basic helix-loop-helix type transcription factors that play key roles in multiple cell behaviors. BHLHE40/41 were recently shown to be involved in an epithelial-to-mesenchymal transition (EMT). However, the precise mechanism of EMT control by BHLHE40/41 remains
Li Yan et al.
American journal of cancer research, 5(4), 1447-1459 (2015-06-24)
Recent evidence suggests that miR-520 family has an important role in regulating tumorigenesis and development of various types of solid cancers. However, as one of the most common cancers in the world, there is little known about the underlying regulatory
Dong-Qin Chen et al.
Oncotarget, 5(10), 3333-3349 (2014-05-17)
Chemoresistance is one of the most significant obstacles in lung adenocarcinoma (LAD) treatment, and this process involves genetic and epigenetic dysregulation of chemoresistance-related genes. Previously, we have shown that restoration of microRNA (miR)-200b significantly reverses chemoresistance of human LAD cells
Sumegha Mitra et al.
PloS one, 9(6), e100169-e100169 (2014-06-19)
Growth arrest DNA damage inducible alpha (GADD45a) is a stress-induced gene we have shown to participate in the pathophysiology of ventilator-induced lung injury (VILI) via regulation of mechanical stress-induced Akt ubiquitination and phosphorylation. The regulation of GADD45a expression by mechanical
Zanhui Jia et al.
Journal of cellular biochemistry, 115(10), 1829-1839 (2014-06-07)
Adamts17 is a member of a family of secreted metalloproteinases. In this report, we show that knockdown of Adamts17 expression induces apoptosis and inhibits breast cancer cell growth. Adamts17 expression can rapidly be induced by estrogens. siRNA knockdown of Sp1

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico