Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU056071

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mavs

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TAGGAAGCCCTGAGCCACTAGCCACCCAGCAGCCCCAAGAAGAGGAAGAACATTGTGCCAGTTCAATGCCCTGGGCTAAGTGGCTTGGGGCCACCAGTGCACTCTTGGCTGTATTCCTGGCAGTGATGCTGTACCGTAGTAGGCGCCTGGCCCAGTGAAGCCTCAGCTGTATGCTGTTCTCTTGCTCAGTTCTGCCAAGCATGTTCTCTAGGCTTGGGCTAGTAGAGGCTGAGTCAGAGAAACTTAAATATGGCGAGGTCCACTGAGCTATCCAGGTAGATAGCTACACCAAGACGTCATCACTGTTGGGTGGGGGAGAGACATTGTTTTATCCTGGTTCATATGTCATCTTCTGGTCTTCAGCTTTTGGAGGCACTGTGTTACCTCCATTGCTCCTGACCTGCCCACGTGGCAGTGTAAGAGTTCATGCTCTGTGCTCCTAAGGAGGTATCTCCACCAGCTTTATCCCTGTTGGCCCAAGCCTGAAGATGAGGAG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Pradip B Devhare et al.
PloS one, 8(5), e63793-e63793 (2013-05-15)
Hepatitis E virus (HEV) is a major cause of enterically transmitted acute hepatitis in developing nations and occurs in sporadic and epidemic forms. The disease may become severe with high mortality (20%) among pregnant women. Due to lack of efficient
Charlotte Odendall et al.
Nature immunology, 15(8), 717-726 (2014-06-24)
Type I interferon responses are considered the primary means by which viral infections are controlled in mammals. Despite this view, several pathogens activate antiviral responses in the absence of type I interferons. The mechanisms controlling type I interferon-independent responses are
Huachen Gan et al.
Scientific reports, 5, 17916-17916 (2015-12-09)
Influenza A virus (IAV) targets airway epithelial cells and exploits the host cell machinery to replicate, causing respiratory illness in annual epidemics and pandemics of variable severity. The high rate of antigenic drift (viral mutation) and the putative antigenic shift

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico