Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EMU050451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Suz12

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGGCTCCTATGCAGGAAATCCTCAGGATATACATCGCCAACCTGGATTTGCTTTTAGTCGAAATGGACCGGTAAAGAGAACACCTATCACACATATTCTTGTTTGCAGGCCAAAAAGAACAAAAGCAAGCATGTCGGAGTTTCTTGAATCTGAAGATGGAGAAGTGGAGCAGCAGAGAACATACAGCAGTGGCCACAATCGTCTCTATTTCCACAGTGATACCTGCTTACCTCTTCGGCCACAAGAAATGGAAGTAGATAGTGAAGATGAGAAAGATCCAGAATGGCTGAGAGAAAAAACCATTACTCAAATTGAAGAATTTTCTGATGTGAATGAAGGAGAGAAAGAAGTGATGAAGCTGTGGAACCTCCATGTCATGAAGCATGGATTTATTGCTGACAATCAAATGAATCATGCCTGTATGCTGTTTG

Ensembl | mouse accession no.

ENSMUSG00000017548

NCBI accession no.

NM_199196

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... SUZ12(52615) , Suz12(52615)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of
Ming-de Huang et al.
Journal of hematology & oncology, 8, 50-50 (2015-05-15)
Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related death, especially in China. And the mechanism of its progression remains poorly understood. Growing evidence indicates that long non-coding RNAs (lncRNAs) are found to be dysregulated in many cancers
Xuefei Shi et al.
Molecular carcinogenesis, 54 Suppl 1, E1-E12 (2013-12-21)
In more recent years, long non-coding RNAs (lncRNAs) have been investigated as a new class of regulators of cellular processes, such as cell growth, apoptosis, and carcinogenesis. Although lncRNAs are dysregulated in numerous cancer types, limited data are available on
Michael Anthony Ruiz et al.
PloS one, 10(4), e0123987-e0123987 (2015-04-18)
Glucose-induced augmented vascular endothelial growth factor (VEGF) production is a key event in diabetic retinopathy. We have previously demonstrated that downregulation of miR-200b increases VEGF, mediating structural and functional changes in the retina in diabetes. However, mechanisms regulating miR-200b in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico