Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU049871

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sox4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAACAGAGTGAGGGGAAGAGGGCCGTCTCCCTCCCGGTTTCCAGTTCTTGCACGCTGTTTCTTAGAGAGTCTGCAGTGGGGGAACTCTGCCGGTAACCAGCTCCCCTTCTTGCAGGAGGGAGGGAGAAACATACATTTATTCATGCCGGTCTGTTGCATGCAAGCTTCTTGGCTTCCTACCTTGCAACAAAATAATTGCACCAACTCCTCAGCGCCGATTCCGCCCACAGAGAGTCCCGGAGCCAGAGTCGCTTTGGCTTTGCACTGCAGGAAAGGGACTTAGGCGCTAGAGACGATGTCGCTTTCCTGAGCTACCGCGAGCTCTCGTGAACTGCAATCGACTGCTTCAGGGAAAGGGGTGGGGGAAAGACTTGCCCCGGAGGCGGCGAGAAACTTGCGTTTGGAAGATACTCCGGCTACCAACGTTT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jie Xi et al.
American journal of cancer research, 7(11), 2180-2189 (2017-12-09)
Ovarian cancer (OC) is one of the most fatal gynecological cancer in women worldwide. Long noncoding RNA (lncRNA) lncBRM was found to be associated with the progression and prognosis of hepatocellular carcinoma (HCC). However, the expression level, clinical significance and
Tae Mi Yoon et al.
BMC cancer, 15, 888-888 (2015-11-12)
In humans, sex-determining region-Y (SRY) related high-mobility-group box 4 (SOX4) is linked to development and tumorigenesis. SOX4 is over-expressed in several cancers and has prognostic significance. This study evaluated whether SOX4 affects oncogenic behavior and chemoradiotherapy response in head and
Chao Chen et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(29), 10629-10642 (2015-07-24)
As the cerebral cortex forms, specialized molecular cascades direct the expansion of progenitor pools, the differentiation of neurons, or the maturation of discrete neuronal subtypes, together ensuring that the correct amounts and classes of neurons are generated. In several neural

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico