Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU047431

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lin28

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGAAGCGAAGATCCAAAGGAGACAGGTGCTACAACTGCGGTGGGCTAGACCATCATGCCAAGGAATGCAAGCTGCCACCCCAGCCCAAGAAGTGCCACTTTTGCCAAAGCATCAACCATATGGTGGCCTCGTGTCCACTGAAGGCCCAGCAGGGCCCCAGTTCTCAGGGAAAGCCTGCCTACTTCCGGGAGGAAGAGGAAGAGATCCACAGCCCTGCCCTGCTCCCAGAAGCCCAGAATTGAGGCCCAGGAGTCAGGGTTATTCTTTGGCTAATGGGGAGTTTAAGGAAAGAGGCATCAATCTGCAGAGTGGAGAAAGTGGGGGTAAGGGTGGGTTGCGTGGGTAGCTTGCACTGCCGTGTCTCAGGCCGGGGTTCCCAGTGTCACCCTGTCTTTCCTTGGAGGGAAGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wensen Ding et al.
International journal of clinical and experimental pathology, 13(5), 1136-1145 (2020-06-09)
As an evolutionarily conserved RNA-binding protein, LIN28 is known to be involved in the regulation of the translation and stability of a large number of mRNAs and the biogenesis of certain miRNAs. Increasing evidence indicates that LIN28 regulates many cellular
Qian Li et al.
Experimental cell research, 388(1), 111718-111718 (2019-12-25)
Successful implantation happens only when the development of a competent blastocyst synchronized with the differentiation of a receptive uterus. The exact mechanism affecting embryo implantation competency is still unclear. Previous data from our laboratory showed that several members of the
Jinzhuo Dou et al.
Molecular oncology, 14(9), 2288-2312 (2020-04-26)
LIN28A is a conserved RNA-binding protein that inhibits the biogenesis of let-7 microRNAs, thus promoting cancer progression. However, mechanisms underlying the activation of the LIN28A-let-7 signaling pathway remain poorly understood. Here, we show that LIN28A is SUMOylated in vivo and in vitro

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico