Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU001091

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Elavl1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTCAGAACATGACCCAAGAGGAACTACGAAGTCTGTTCAGCAGCATTGGCGAGGTTGAATCTGCAAAGCTTATTCGGGATAAAGTAGCAGGACACAGCTTGGGCTACGGTTTTGTGAACTATGTGACTGCAAAAGATGCAGAGAGAGCAATCAGCACACTGAACGGCTTGAGACTCCAGTCCAAAACCATTAAGGTGTCATATGCTCGCCCAAGCTCAGAGGTCATCAAAGATGCCAACTTATACATCAGTGGGCTCCCAAGGACCATGACACAGAAGGATGTGGAAGACATGTTTTCTCGGTTTGGGCGAATCATCAACTCCAGGGTCCTTGTGGATCAGACCACAGGTTTGTCCAGAGGGGTTGCCTTTATCCGGTTTGACAAACGGTCAGAAGCAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Danping Wu et al.
Clinical laboratory, 61(11), 1625-1634 (2016-01-07)
Increasing evidence suggests that microRNAs are widely involved in cancer progression and metastasis. However, the specific role of miR-31 in papillary thyroid carcinoma (PTC) is still largely unknown. The level of miR-31 and HuR was detected in 30 pairedcancerous and
Kotb Abdelmohsen et al.
Nucleic acids research, 42(15), 10099-10111 (2014-08-16)
Noncoding RNAs (ncRNAs) and RNA-binding proteins are potent post-transcriptional regulators of gene expression. The ncRNA 7SL is upregulated in cancer cells, but its impact upon the phenotype of cancer cells is unknown. Here, we present evidence that 7SL forms a
Kenneth K W To et al.
Experimental cell research, 338(2), 222-231 (2015-09-20)
Colorectal cancer (CRC) is a major cause of mortality and morbidity worldwide. While surgery remains the mainstay of treatment for early stage CRC, adjuvant chemotherapy is usually given to reduce the risk of recurrence after colectomy. Overexpression of a multidrug
Cristina M Ramírez et al.
Journal of lipid research, 55(6), 1066-1076 (2014-04-15)
ABCA1 is a major regulator of cellular cholesterol efflux and plasma HDL biogenesis. Even though the transcriptional activation of ABCA1 is well established, the posttranscriptional regulation of ABCA1 expression is poorly understood. Here, we investigate the potential contribution of the
Jeong-Dan Cha et al.
Head & neck, 36(8), 1168-1175 (2013-07-16)
HuR expression has been noted in several cancer types, in which it may contribute to increased expression of cellular inhibitors of apoptosis protein-2 (cIAP2) observed during tumorigenesis. To assess the correlation between cIAP2 and HuR in cases of oral squamous

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico