Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU000731

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ywhaz

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCTGCTCTCTTGCAAAAACAGCTTTCGATGAAGCCATTGCTGAACTTGATACATTAAGTGAAGAGTCGTACAAAGACAGCACGCTAATAATGCAGTTACTGAGAGACAACTTAACATTGTGGACATCGGATACCCAAGGAGATGAAGCAGAAGCAGGAGAAGGAGGGGAAAATTAACCGGCCTTCCAACCTTTGTCTGCCTCATTCTAAAATTTACACAGTAGACCATTTGTCATCCATGCTGTCCCACAGATAGTTTTTTTGTTTACGATTTATGACAGGTTTATGTTACTTCTATTTGAATTTCTATATTTCCCATGTGGTTTTTATGTTTTAATATTAGGGGAGTAGAGCCAGTTAACTTTAGGGAGTTACTCATTTTCATCTTGAGGTGGCCAAT

Ensembl | nº de acceso | ratón

ENSMUSG00000022285

Nº de acceso NCBI

NP_035870

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... YWHAZ(22631) , Ywhaz(22631)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ZCV
WXU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Langyong Mao et al.
American journal of cancer research, 5(6), 1939-1953 (2015-08-14)
The deregulation of microRNAs has been demonstrated in various tumor processes. Here, we report that microRNA-544 (miR-544) is decreased in cervical cancer tissues compared with normal cervical tissues. To identify the mechanisms involved in miR-544 deregulation, we studied the regulation
Gareth E Lim et al.
Nature communications, 6, 7671-7671 (2015-07-30)
The proteins that coordinate complex adipogenic transcriptional networks are poorly understood. 14-3-3ζ is a molecular adaptor protein that regulates insulin signalling and transcription factor networks. Here we report that 14-3-3ζ-knockout mice are strikingly lean from birth with specific reductions in
Hillary E Mulvey et al.
BMC cancer, 15, 571-571 (2015-08-02)
Extracellular vesicles (EVs) are secreted from many cells, carrying cargoes including proteins and nucleic acids. Research has shown that EVs play a role in a variety of biological processes including immunity, bone formation and recently they have been implicated in

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico