Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU232231

Sigma-Aldrich

MISSION® esiRNA

targeting human IRGM

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGAAGCCATGAATGTTGAGAAAGCCTCAGCAGATGGGAACTTGCCAGAGGTGATCTCTAACATCAAGGAGACTCTGAAGATAGTGTCCAGGACACCAGTTAACATCACTATGGCAGGGGACTCTGGCAATGGGATGTCCACCTTCATCAGTGCCCTTCGAAACACAGGACATGAGGGTAAGGCCTCACCTCCTACTGAGCTGGTAAAAGCTACCCAAAGATGTGCCTCCTATTTCTCTTCCCACTTTTCAAATGTGGTGTTGTGGGACCTGCCTGGCACAGGGTCTGCCACCACAACCCTGGAGAACTACCTGATGGAAATGCAGTTCAACCGGTATGACTTCATCATGGTTGCATCTGCACAATTCAGCATGAATCATGTGATGCTTGCCAAAACCGCTGAGGACATGGGAAAGAAGTTCTACATTGTCTGGACCAAGCTAGACATGGACCTCAGCACAGGTGCCCTCCCAGAAGTGCAGCTACTGCAGATCAGAGAAAATGTCCTGGAAAA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yu-Cheng Lin et al.
Journal of hepatology, 65(6), 1209-1216 (2016-07-16)
Autophagy has been shown to be crucial in the regulation of the intracellular lipid stores in hepatocytes. We hypothesize that immunity-related GTPase family M (IRGM) gene (an autophagy-related gene) variants confer the susceptibility to non-alcoholic fatty liver disease (NAFLD) development.
Chih-Peng Chang et al.
PloS one, 6(12), e28323-e28323 (2011-12-14)
Interferon-gamma (IFN-γ), a potent Th1 cytokine with multiple biological functions, can induce autophagy to enhance the clearance of the invading microorganism or cause cell death. We have reported that Concanavalin A (Con A) can cause autophagic cell death in hepatocytes
Kautilya Kumar Jena et al.
EMBO reports, 21(9), e50051-e50051 (2020-07-28)
Activation of the type 1 interferon response is extensively connected to the pathogenesis of autoimmune diseases. Loss of function of Immunity Related GTPase M (IRGM) has also been associated to several autoimmune diseases, but its mechanism of action is unknown.
Xize Guo et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(11), 14768-14779 (2020-09-18)
Mitochondria is a double membrane-bound cellular organelle that generates energy to maintain the homeostasis of cells. Immunity-related GTPase M (IRGM) in human locates at the inner membrane of mitochondria and is best known for its role in regulating autophagy against

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico