Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU226031

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF9, RP11-468E2.4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 918,00

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 918,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAGCTGTCTGGAAGACTCGCCTGCGCTGTGCACTCAACAAGAGTTCTGAATTTAAGGAGGTTCCTGAGAGGGGCCGCATGGATGTTGCTGAGCCCTACAAGGTGTATCAGTTGCTGCCACCAGGAATCGTCTCTGGCCAGCCAGGGACTCAGAAAGTACCATCAAAGCGACAGCACAGTTCTGTGTCCTCTGAGAGGAAGGAGGAAGAGGATGCCATGCAGAACTGCACACTCAGTCCCTCTGTGCTCCAGGACTCCCTCAATAATGAGGAGGAGGGGGCCAGTGGGGGAGCAGTCCATTCAGACATTGGGAGCAGCAGCAGCAGCAGCAGCCCTGAGCCACAGGAAGTTACAGACACAACTGAGGCCCCCTTTCAAGGGGATCAGAGGTCCCTGGAGTTTCTGCTTCCTCCAGAGC

Ensembl | nº de acceso humano

ENSG00000213928

Nº de acceso NCBI

NM_006084

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IRF9(10379) , IRF9(10379)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QAU
QQT
WAT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nicholas Hernandez et al.
The Journal of experimental medicine, 215(10), 2567-2585 (2018-08-26)
Life-threatening pulmonary influenza can be caused by inborn errors of type I and III IFN immunity. We report a 5-yr-old child with severe pulmonary influenza at 2 yr. She is homozygous for a loss-of-function IRF9 allele. Her cells activate gamma-activated
Nadiia Lypova et al.
Cancers, 11(5) (2019-05-19)
While clinical responses to palbociclib have been promising, metastatic breast cancer remains incurable due to the development of resistance. We generated estrogen receptor-positive (ER+) and ER-negative (ER-) cell line models and determined their permissiveness and cellular responses to an oncolytic
Adriana Forero et al.
Immunity, 51(3), 451-464 (2019-09-01)
Type I and III interferons (IFNs) activate similar downstream signaling cascades, but unlike type I IFNs, type III IFNs (IFNλ) do not elicit strong inflammatory responses in vivo. Here, we examined the molecular mechanisms underlying this disparity. Type I and III
Marieke C Verweij et al.
PLoS pathogens, 11(5), e1004901-e1004901 (2015-05-15)
Varicella zoster virus (VZV) causes chickenpox in humans and, subsequently, establishes latency in the sensory ganglia from where it reactivates to cause herpes zoster. Infection of rhesus macaques with simian varicella virus (SVV) recapitulates VZV pathogenesis in humans thus representing

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico