Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU158541

Sigma-Aldrich

MISSION® esiRNA

targeting human GAS7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAGGTTAAAGCCATTGTGCTAAGATCTAATCTGAGGACACTATAATGGCCCTGTCGTCAGGGAAGCCCGTGATCGCTCGTTTTCAGGGGTCTTACCGGTCAGCAACCTTGGCATTGATACATAGGCACTCTACAGAATTTAAGTTTTCAGAGGTAAGTCTGTTGTTCTGATTAATCTGCATTCATTCAGCGAATGCTCAAGACAAGCCAGGCATGCTGAGAAGCGGCGCTCTAGTTGTATGTAAGATGGGCATTCCTCTGCTCTCCTCTATTCTCCATGTCGACTGAGAAGAGTATAATAAGAACATTGTACCCTCTCCACACTTAACCCTCTGGGATTCTTTATTATAATATAAACCACCGTCGTGAGGCATTTACCTGTTGGATGGAAGGTAGACAGCA

Ensembl | nº de acceso humano

ENSG00000007237

Nº de acceso NCBI

NM_201433

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GAS7(8522) , GAS7(8522)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kyoko Hanawa-Suetsugu et al.
Nature communications, 10(1), 4763-4763 (2019-10-20)
Phagocytosis is a cellular process for internalization of micron-sized large particles including pathogens. The Bin-Amphiphysin-Rvs167 (BAR) domain proteins, including the FCH-BAR (F-BAR) domain proteins, impose specific morphologies on lipid membranes. Most BAR domain proteins are thought to form membrane invaginations
Douglas Hanniford et al.
Cancer cell, 37(1), 55-70 (2020-01-15)
Metastasis is the primary cause of death of cancer patients. Dissecting mechanisms governing metastatic spread may uncover important tumor biology and/or yield promising therapeutic insights. Here, we investigated the role of circular RNAs (circRNA) in metastasis, using melanoma as a

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico