Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU157961

Sigma-Aldrich

MISSION® esiRNA

targeting human CD74

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACACAGGCTTTTCCATCCTGGTGACTCTGCTCCTCGCTGGCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAACTGACAGTCACCTCCCAGAACCTGCAGCTGGAGAACCTGCGCATGAAGCTTCCCAAGCCTCCCAAGCCTGTGAGCAAGATGCGCATGGCCACCCCGCTGCTGATGCAGGCGCTGCCCATGGGAGCCCTGCCCCAGGGGCCCATGCAGAATGCCACCAAGTATGGCAACATGACAGAGGACCATGTGATGCACCTGCTCCAGAATGCTGACCCCCTGAAGGTGTACCCGCCACTGAAGGGGAGCTTCCCGGAGAACCTGAGACACCTTAAGAACACCATGGAGACCATAGACTGGAAGGTCTTTGAGAGCTGGATGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Pei-Chi Chan et al.
Clinical science (London, England : 1979), 132(14), 1581-1596 (2018-05-19)
Adipose tissue (AT) inflammation is crucial to the development of obesity-associated insulin resistance. Our aim was to investigate the contribution of cyclooxygenase-2 (COX-2)/macrophage migration inhibitory factor (MIF)-mediated cross-talk between hypertrophic adipocytes and macrophages to the etiology of AT inflammation and
Jing-Nan Liang et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(9), 2441-2450 (2019-06-09)
Although macrophage migration inhibitory factor (MIF) is known to have antioxidant property, the role of MIF in cardiac fibrosis has not been well understood. We found that MIF was markedly increased in angiotension II (Ang-II)-infused mouse myocardium. Myocardial function was
Jun-Wei Gai et al.
Oncology letters, 15(5), 7631-7638 (2018-05-08)
The aim of the present study was to investigate the expression and potential roles of CD74 in human urothelial cell carcinoma of the bladder (UCB) in vitro and in vivo. CD74 and macrophage migration inhibitory factor (MIF) were located and
Caitlin J Bowen et al.
Developmental biology, 407(1), 145-157 (2015-07-19)
Proper remodeling of the endocardial cushions into thin fibrous valves is essential for gestational progression and long-term function. This process involves dynamic interactions between resident cells and their local environment, much of which is not understood. In this study, we
Franziska Uhlenbrock et al.
Journal of immunology (Baltimore, Md. : 1950), 193(4), 1654-1665 (2014-07-16)
Soluble ULBP2 is a marker for poor prognosis in several types of cancer. In this study we demonstrate that both soluble and cell surface-bound ULBP2 is transported via a so far unrecognized endosomal pathway. ULBP2 surface expression, but not MICA/B

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico