Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU156971

Sigma-Aldrich

MISSION® esiRNA

targeting human ERCC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAATATGCCATCTCACAGCCTCTGGAAGGGGCTGGGGCCACGTGCCCCACAGGGTCAGAGCCCCTGGCAGGAGAGACGCCCAACCAGGCCCTGAAACCCGGGGCAAAATCCAACAGCATCATTGTGAGCCCTCGGCAGAGGGGCAATCCCGTACTGAAGTTCGTGCGCAATGTGCCCTGGGAATTTGGCGACGTAATTCCCGACTATGTGCTGGGCCAGAGCACCTGTGCCCTGTTCCTCAGCCTCCGCTACCACAACCTGCACCCAGACTACATCCATGGGCGGCTGCAGAGCCTGGGGAAGAACTTCGCCTTGCGGGTCCTGCTTGTCCAGGTGGATGTGAAAGATCCCCAGCAGGCCCTCAAGGAGCTGGCTAAGATGTGTATCCTGGCCGACTGCACATTGATCCTCGCCTGGAGCCCCGAGGAAGCTGGGCGGTACCTGGAGACCTACAAGGCCTATGAGCAGAAACCAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei-Ping Lee et al.
Biochimica et biophysica acta, 1863(4), 917-928 (2017-01-16)
Gemcitabine and capecitabine are two effective anticancer agents against solid tumors. The pharmacological mechanisms have been known as incorporation into DNA and thereby inhibition of DNA synthesis. When used as metronomic chemotherapy, they may inhibit angiogenesis and induce immunity. In
Jae Joon Han et al.
Cancer research and treatment : official journal of Korean Cancer Association, 46(1), 55-64 (2014-02-13)
The novel heat shock protein tumor necrosis factor receptor-associated protein 1 (TRAP1) is associated with multidrug resistance in colorectal cancer (CRC) cells in vitro. Excision repair cross-complementation group 1 (ERCC1) expression levels in tumor tissues also predict clinical outcomes in
Daniel P Feldmann et al.
Molecules (Basel, Switzerland), 25(8) (2020-04-30)
Platinum-based chemotherapy remains a mainstay treatment for the management of advanced non-small cell lung cancer. A key cellular factor that contributes to sensitivity to platinums is the 5'-3' structure-specific endonuclease excision repair cross-complementation group 1 (ERCC1)/ xeroderma pigmentosum group F
Gianmaria Liccardi et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(13), 3496-3506 (2014-05-02)
The epidermal growth factor receptor (EGFR) plays an important role in cellular response to chemotherapy and radiotherapy through modulation of DNA repair. EGFR activates DNA-dependent protein kinase (DNA-PK) stimulating repair of DNA strand breaks (SB) and interstrand crosslinks (ICL). We
Ying Wai Chan et al.
Nature cell biology, 20(1), 92-103 (2017-12-20)
The resolution of joint molecules that link recombining sister chromatids is essential for chromosome segregation. Here, we determine the fate of unresolved recombination intermediates arising in cells lacking two nucleases required for resolution (GEN1 -/- knockout cells depleted of MUS81).

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico