Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU156131

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGACAAAGTTCGGGTCATGGCAGACTCTATGCAAGAGAAGCAACGTATGGCAGGACAAATGCTTCTTCAAACCTTTTTTAACATAGACCAAATATCCCCCAATAAAAAAGCTCATCCGAATATGGAGGCTGGACCACCTGAGTCAGGAGAATCTACAGATGCCCTCAAGCTTTGTCCTCATGAAGAATTCCTGAGACTATGTAAAGAAAGAGCTGAAGAGATCTATCCAATAAAGGAGAGAAACAACCGCACACGCCTGGCTCTCATCATATGCAATACAGAGTTTGACCATCTGCCTCCGAGGAATGGAGCTGACTTTGACATCACAGGGATGAAGGAGCTACTTGAGGGTCTGGACTATAGTGTAGATGTAGAAGAGAATCTGACAGCCAGGGATATGGAGTCAGCGCTGAGGGCATTTGCTACCAGACCAGAGCACAAGTCCTCTGACAGCA

Ensembl | human accession no.

ENSG00000196954

NCBI accession no.

NM_033306

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CASP4(837) , CASP4(837)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
IKU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chanya Srisaowakarn et al.
Infection and immunity, 88(3) (2019-12-11)
Melioidosis is an infectious disease with a high mortality rate responsible for community-acquired sepsis in Southeast Asia and Northern Australia. The causative agent of this disease is Burkholderia pseudomallei, a Gram-negative bacterium that resides in soil and contaminated natural water.
Kwong Tai Cheng et al.
The Journal of clinical investigation, 127(11), 4124-4135 (2017-10-11)
Acute lung injury is a leading cause of death in bacterial sepsis due to the wholesale destruction of the lung endothelial barrier, which results in protein-rich lung edema, influx of proinflammatory leukocytes, and intractable hypoxemia. Pyroptosis is a form of
Qiyun Zhong et al.
PLoS biology, 18(12), e3000986-e3000986 (2020-12-31)
Clustering of the enteropathogenic Escherichia coli (EPEC) type III secretion system (T3SS) effector translocated intimin receptor (Tir) by intimin leads to actin polymerisation and pyroptotic cell death in macrophages. The effect of Tir clustering on the viability of EPEC-infected intestinal
Nicolas J Pillon et al.
American journal of physiology. Endocrinology and metabolism, 311(5), E825-E835 (2016-11-03)
Obesity is associated with metabolic tissue infiltration by monocyte-derived macrophages. Saturated fatty acids contribute to proinflammatory gene induction in tissue-embedded immune cells. However, it is unknown how circulating monocytes, the macrophage precursors, react to high-fat environments. In macrophages, saturated fatty
Yubo Tang et al.
Oxidative medicine and cellular longevity, 2020, 7409853-7409853 (2020-08-01)
Lung cancer is the most common and lethal malignant disease for which the development of efficacious chemotherapeutic agents remains an urgent need. Pristimerin (PRIS), a natural bioactive component isolated from various plant species in the Celastraceae and Hippocrateaceae families, has
Ver todos los artículos relacionados

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico