Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU155311

Sigma-Aldrich

MISSION® esiRNA

targeting human PTCH1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTCGCCAGAAGATTGGAGAAGAGGCTATGTTTAATCCTCAACTCATGATACAGACCCCTAAAGAAGAAGGTGCTAATGTCCTGACCACAGAAGCGCTCCTACAACACCTGGACTCGGCACTCCAGGCCAGCCGTGTCCATGTATACATGTACAACAGGCAGTGGAAATTGGAACATTTGTGTTACAAATCAGGAGAGCTTATCACAGAAACAGGTTACATGGATCAGATAATAGAATATCTTTACCCTTGTTTGATTATTACACCTTTGGACTGCTTCTGGGAAGGGGCGAAATTACAGTCTGGGACAGCATACCTCCTAGGTAAACCTCCTTTGCGGTGGACAAACTTCGACCCTTTGGAATTCCTGGAAGAGTTAAAGAAAATAAACTATCAAGTGGACAGCTGGGAG

Ensembl | human accession no.

ENSG00000185920

NCBI accession no.

NM_001083604

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PTCH1(5727) , PTCH1(5727)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yingying Hong et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 31(7), 1413-1428 (2016-02-19)
Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominant disorder characterized by bone and skin abnormalities and a predisposition to various tumors. Keratocystic odontogenic tumors (KCOTs), which are common tumors of the jaw that cause extensive damage to the
Xuechao Wan et al.
Oncotarget, 9(4), 4798-4813 (2018-02-13)
Metastasis is the most common cause of mortality for non-small cell lung cancer (NSCLC). PTCH1, a receptor of Hedgehog (Hh) pathway, is reported to suppress cell proliferation. Interestingly, our previous study showed PTCH1 silencing promoted cell proliferation but inhibited cell
A Tam et al.
Scientific reports, 9(1), 3353-3353 (2019-03-06)
Genome-wide association studies have linked gene variants of the receptor patched homolog 1 (PTCH1) with chronic obstructive pulmonary disease (COPD). However, its biological role in the disease is unclear. Our objective was to determine the expression pattern and biological role
Jeanne L Theis et al.
eLife, 9 (2020-10-03)
Congenital heart diseases (CHDs), including hypoplastic left heart syndrome (HLHS), are genetically complex and poorly understood. Here, a multidisciplinary platform was established to functionally evaluate novel CHD gene candidates, based on whole-genome and iPSC RNA sequencing of a HLHS family-trio.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico