Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU154411

Sigma-Aldrich

MISSION® esiRNA

targeting human AHCY

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGCAAGCTGAATGTGAAGTTGACCAAGCTAACTGAGAAGCAAGCCCAGTACCTGGGCATGTCCTGTGATGGCCCCTTCAAGCCGGATCACTACCGCTACTGAGAGCCAGGTCTGCGTTTCACCCTCCAGCTGCTGTCCTTGCCCAGGCCCCACCTCTCCTCCCTAAGAGCTAATGGCACCAACTTTGTGATTGGTTTGTCAGTGTCCCCCATCGACTCTCTGGGGCTGATCACTTAGTTTTTGGCCTCTGCTGCAGCCGTCATACTGTTCCAAATGTGGCAGCGGGAACAGAGTACCCTCTTCAAGCCCCGGTCATGATGGAGGTCCCAGCCACAGGGAACCATGAGCTCAGTGGTCTTGGAACAGCTCACTAAGTCAGTCCTTCCTTAGCCTGGAAGTCAGTAGTGGAGTCACAAAGCCCATGTGTTTTGCCATCTAGGCCTTCACCTGGTCTGTGGACTTATACCTGTGTGCTTGGTTTACAGGTCCAGTGGTTCTTCAGCCCATGACAGATGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

V K Chaithanya Ponnaluri et al.
Journal of molecular biology, 430(14), 2051-2065 (2018-05-15)
DNA (cytosine-5) methyltransferase 1 (DNMT1) is essential for mammalian development and maintenance of DNA methylation following DNA replication in cells. The DNA methylation process generates S-adenosyl-l-homocysteine, a strong inhibitor of DNMT1. Here we report that S-adenosylhomocysteine hydrolase (SAHH/AHCY), the only
Carolina Magdalen Greco et al.
Science advances, 6(51) (2020-12-18)
Circadian gene expression driven by transcription activators CLOCK and BMAL1 is intimately associated with dynamic chromatin remodeling. However, how cellular metabolism directs circadian chromatin remodeling is virtually unexplored. We report that the S-adenosylhomocysteine (SAH) hydrolyzing enzyme adenosylhomocysteinase (AHCY) cyclically associates
Sae Jeong Park et al.
American journal of cancer research, 5(7), 2127-2138 (2015-09-04)
S-adenosylhomocysteine hydrolase (AHCY) hydrolyzes S-adenosylhomocysteine to adenosine and l-homocysteine, and it is already known that inhibition of AHCY decreased cell proliferation by G2/M arrest in MCF7 cells. However, the previous study has not indicated what mechanism the cell cycle arrest

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico