Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU150721

Sigma-Aldrich

MISSION® esiRNA

targeting human RUVBL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGGGATGTGCACAAAAAGAAAGAAATCATCCAAGATGTGACCTTGCATGACTTGGATGTGGCTAATGCGCGGCCCCAGGGGGGACAAGATATCCTGTCCATGATGGGCCAGCTAATGAAGCCAAAGAAGACAGAAATCACAGACAAACTTCGAGGGGAGATTAATAAGGTGGTGAACAAGTACATCGACCAGGGCATTGCTGAGCTGGTCCCGGGTGTGCTGTTTGTTGATGAGGTCCACATGCTGGACATTGAGTGCTTCACCTACCTGCACCGCGCCCTGGAGTCTTCTATCGCTCCCATCGTCATCTTTGCATCCAACCGAGGCAACTGTGTCATCAGAGGCACTGAGGACATCACATCCCCTCACGGCATCCCTCTTGACCTTCTGGACCGAGTGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

O Breig et al.
Leukemia, 28(6), 1271-1279 (2013-12-18)
The oncogenic fusion protein AML1-ETO, also known as RUNX1-RUNX1T1 is generated by the t(8;21)(q22;q22) translocation, one of the most frequent chromosomal rearrangements in acute myeloid leukemia (AML). Identifying the genes that cooperate with or are required for the oncogenic activity
Fabian Zimmermann et al.
Science advances, 6(51) (2020-12-24)
The microtubule nucleator γ-tubulin ring complex (γTuRC) is essential for the function of microtubule organizing centers such as the centrosome. Since its discovery over two decades ago, γTuRC has evaded in vitro reconstitution and thus detailed structure-function studies. Here, we
M Jane Morwitzer et al.
Viruses, 11(4) (2019-04-26)
Ebola virus (EBOV) is a filovirus that has become a global public health threat in recent years. EBOV is the causative agent of a severe, often fatal hemorrhagic fever. A productive viral infection relies on the successful recruitment of host

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico