Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU150021

Sigma-Aldrich

MISSION® esiRNA

targeting human ALAD

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCGGTGATGAGCTACAGTGCCAAATTTGCTTCCTGTTTCTATGGCCCTTTCCGGGATGCAGCTAAGTCAAGCCCAGCTTTTGGGGACCGCCGCTGCTACCAGCTGCCCCCTGGAGCACGAGGCCTGGCTCTCCGAGCTGTGGACCGGGATGTACGGGAAGGAGCTGACATGCTCATGGTGAAGCCGGGAATGCCCTACCTGGACATCGTGCGGGAGGTAAAGGACAAGCACCCTGACCTCCCTCTCGCCGTGTACCACGTCTCTGGAGAGTTTGCCATGCTGTGGCATGGAGCCCAGGCCGGGGCATTTGATCTCAAGGCTGCCGTACTGGAGGCCATGACTGCCTTCCGCAGAGCAGGTGCTGACATCATCATCACCTACTACACACCGCAGCTGCTGCAGTGGCTGAAGGAGGAATGATGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Guicai Gao et al.
Developmental and comparative immunology, 98, 99-107 (2019-05-06)
White spot syndrome, which is caused by white spot syndrome virus (WSSV), is a highly contagious disease of penaeid shrimp. However, there is currently incomplete understanding of the infection mechanism and pathogenesis of WSSV. In this study, a novel gene
Zhou Zheng et al.
Fish & shellfish immunology, 81, 168-175 (2018-07-17)
Shrimps, which mainly rely on their innate immune system to response to infectious pathogens, have clottable proteins as an important component of this system. While transglutaminases (TGase) are found in Litopenaeus vannamei and constitute part of the coagulation system, the
Gang Liu et al.
Nature communications, 11(1), 6310-6310 (2020-12-11)
Heme biosynthesis and iron-sulfur cluster (ISC) biogenesis are two major mammalian metabolic pathways that require iron. It has long been known that these two pathways interconnect, but the previously described interactions do not fully explain why heme biosynthesis depends on

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico