Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU144531

Sigma-Aldrich

MISSION® esiRNA

targeting human FCGR2A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCAATTCCACTGATCCTGTGAAGGCTGCCCAATTTGAGCCACCTGGACGTCAAATGATTGCCATCAGAAAGAGACAACTTGAAGAAACCAACAATGACTATGAAACAGCTGACGGCGGCTACATGACTCTGAACCCCAGGGCACCTACTGACGATGATAAAAACATCTACCTGACTCTTCCTCCCAACGACCATGTCAACAGTAATAACTAAAGAGTAACGTTATGCCATGTGGTCATACTCTCAGCTTGCTGAGTGGATGACAAAAAGAGGGGAATTGTTAAAGGAAAATTTAAATGGAGACTGGAAAAATCCTGAGCAAACAAAACCACCTGGCCCTTAGAAATAGCTTTAACTTTGCTTAAACTACAAACACAAGCAAAACTTCACGGGGTCATACTACATACAAGCATAAGCAAAACTTAACTTGGATCATTTCTGGTAAATGCTTATGTTAGAAATAAGACAACCCCAGCCAATC

Ensembl | nº de acceso humano

ENSG00000143226

Nº de acceso NCBI

NM_001136219

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FCGR2A(2212) , FCGR2A(2212)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Esther Shuyi Gan et al.
The EMBO journal, 36(10), 1348-1363 (2017-03-23)
Dengue virus (DENV) has been found to replicate in lymphoid organs such as the lymph nodes, spleen, and liver in post-mortem analysis. These organs are known to have low oxygen levels (~0.5-4.5% O
Laura A Henze et al.
Aging, 11(15), 5445-5462 (2019-08-05)
Medial vascular calcification occurs during the aging process and is strongly accelerated by chronic kidney disease (CKD). Elevated C-reactive protein (CRP) levels are associated with vascular calcification, cardiovascular events and mortality in CKD patients. CRP is an important promoter of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico