Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU141651

Sigma-Aldrich

MISSION® esiRNA

targeting human ESR1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCACCCTGAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGACAAGATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAGCACCAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAAGGCATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTGCTGGAGATGCTGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTGGAGGAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sarah R Hosford et al.
Molecular oncology, 13(8), 1778-1794 (2019-06-11)
Estrogens have been shown to elicit anticancer effects against estrogen receptor α (ER)-positive breast cancer. We sought to determine the mechanism underlying the therapeutic response. Response to 17β-estradiol was assessed in ER+ breast cancer models with resistance to estrogen deprivation:
Shan Gao et al.
Frontiers in oncology, 10, 753-753 (2020-06-06)
Background: Dysregulation of ESR1 accounts for endocrine therapy resistance and metastasis of ERα positive breast cancer. However, the underlying molecular mechanism of ESR1 in ERα positive breast cancer remains insufficiency. Notably, to date, a comprehensive miRNA-mRNA regulatory network involved in
Keivan Mobini et al.
Journal of biochemical and molecular toxicology, e22304-e22304 (2019-02-20)
The underlying functions of miR-206, miR-133a, miR-27b, and miR-21, and their link to the estrogen receptor alpha (ERα) and aryl hydrocarbon receptor (AhR) signaling pathways remain largely unexplored. In this study, we detect the expression of miR-206, miR-133a, miR-27b, and
Fang Liu et al.
Molecular diagnosis & therapy, 22(5), 551-569 (2018-06-22)
Small interfering RNAs (siRNAs) are an attractive new agent with potential as a therapeutic tool because of its ability to inhibit specific genes for many conditions, including viral infections and cancers. However, despite this potential, many challenges remain, including off-target
Chia-Hsin Su et al.
PloS one, 11(11), e0166090-e0166090 (2016-11-03)
Cytokines are low molecular weight regulatory proteins, or glycoproteins, with both tumor-promoting and inhibitory effects on breast cancer growth. Different cytokines play important roles in breast cancer initiation and progression. Here, we show that of the 39 interleukin (IL) genes

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico