Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU137671

Sigma-Aldrich

MISSION® esiRNA

targeting human SIX1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00


Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00


Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTAAGAACCGGAGGCAAAGAGACCGGGCCGCGGAGGCCAAGGAAAGGGAGAACACCGAAAACAATAACTCCTCCTCCAACAAGCAGAACCAACTCTCTCCTCTGGAAGGGGGCAAGCCGCTCATGTCCAGCTCAGAAGAGGAATTCTCACCTCCCCAAAGTCCAGACCAGAACTCGGTCCTTCTGCTGCAGGGCAATATGGGCCACGCCAGGAGCTCAAACTATTCTCTCCCGGGCTTAACAGCCTCGCAGCCCAGTCACGGCCTGCAGACCCACCAGCATCAGCTCCAAGACTCTCTGCTCGGCCCCCTCACCTCCAGTCTGGTGGACTTGGGGTCCTAAGTGGGGAGGGACTGGGGCCTCGAAGGGATTCCTGGAGCAGCAACCACTGCAGCGACTAGGGACACTTGTAAATAGAAATCAGGAACATTTTTGCAGCTTGTTTCTGGAGTTGTTTGCGCATAAAGGAATGGTGGACTTTCACAAATATCTTTTTAAAAATCAAAACCAACAGCGATCTCAAGCT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hongming Wang et al.
Journal of Cancer, 11(9), 2529-2539 (2020-03-24)
SIX1 overexpression has been reported in several cancers. However, its involvement in head and neck squamous cell carcinoma (HNSCC) remains unclear. In this study we investigated the clinical significance and biological roles of SIX1 in HNSCC. SIX1 expression was upregulated
Chao Yu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 105, 10-17 (2018-05-29)
Osteosarcoma is the most common form of primary malignant bone cancer which is most prevalent in children and adolescents. Dysregulated expressions of SIX1 and PTEN/PI3K/AKT have been demonstrated in bone malignancies including osteosarcoma. However, the mechanism of SIX1/PTEN/PI3K/AKT on osteosarcoma

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico