Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU136431

Sigma-Aldrich

MISSION® esiRNA

targeting human NRGN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAAATCCAGGCGAGTTTTCGGGGCCACATGGCGCGGAAGAAGATAAAGAGCGGAGAGCGCGGCCGGAAGGGCCCGGGCCCTGGGGGGCCTGGCGGAGCTGGGGTGGCCCGGGGAGGCGCGGGCGGCGGCCCCAGCGGAGACTAGGCCAGAAGAACTGAGCATTTTCAAAGTTCCCGAGGAGAGATGGATGCCGCGTCCCCTTCGCAGCGACGAGACTTCCCTGCCGTGTTTGTGACCCCCTCCTGCCCAGCAACCTGCCAGCTACAGGAGCCCCCTGCGTCCCAGAGACTCCCTCACCCAGGCAGGCTCCGTCGCGGAGTCGCTGAGTCCGTGCCCTTTTAGTTAGTTCTGCAGTCTAGTATGGTCCCCATTTGCCCTTCCACTCCACCCCACCCTAAACCATGCGCTCCCAATCTTCCTTCTTTTGCTTCTCGC

Ensembl | human accession no.

ENSG00000154146

NCBI accession no.

NM_001126181

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NRGN(4900) , NRGN(4900)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mirko Theis et al.
Journal of biomolecular screening, 20(8), 1018-1026 (2015-04-26)
Broad sequencing enterprises such as the FANTOM or ENCODE projects have substantially extended our knowledge of the human transcriptome. They have revealed that a large portion of genomic DNA is actively transcribed and have identified a plethora of novel transcripts.
Isabel Weinheimer et al.
The Journal of general virology, 95(Pt 2), 486-495 (2013-11-05)
Sweet potato chlorotic stunt virus (SPCSV; genus Crinivirus, family Closteroviridae) causes heavy yield losses in sweet potato plants co-infected with other viruses. The dsRNA-specific class 1 RNase III-like endoribonuclease (RNase3) encoded by SPCSV suppresses post-transcriptional gene silencing and eliminates antiviral
Mariana Marin et al.
Viruses, 11(2) (2019-01-30)
The HIV-1 entry pathway into permissive cells has been a subject of debate. Accumulating evidence, including our previous single virus tracking results, suggests that HIV-1 can enter different cell types via endocytosis and CD4/coreceptor-dependent fusion with endosomes. However, recent studies
Deanna M Santer et al.
Journal of immunological methods, 445, 15-22 (2017-03-10)
Type III interferons (IFN-lambdas) are important antiviral cytokines that also modulate immune responses acting through a unique IFN-λR1/IL-10R2 heterodimeric receptor. Conflicting data has been reported for which cells express the IFN-λR1 subunit and directly respond to IFN-λs. In this study
Colin Watanabe et al.
RNA biology, 13(1), 25-33 (2016-01-21)
Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico