Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU131661

Sigma-Aldrich

MISSION® esiRNA

targeting human ABCB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

US$ 534,00

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCATGCTCAGACAGGATGTGAGTTGGTTTGATGACCCTAAAAACACCACTGGAGCATTGACTACCAGGCTCGCCAATGATGCTGCTCAAGTTAAAGGGGCTATAGGTTCCAGGCTTGCTGTAATTACCCAGAATATAGCAAATCTTGGGACAGGAATAATTATATCCTTCATCTATGGTTGGCAACTAACACTGTTACTCTTAGCAATTGTACCCATCATTGCAATAGCAGGAGTTGTTGAAATGAAAATGTTGTCTGGACAAGCACTGAAAGATAAGAAAGAACTAGAAGGTTCTGGGAAGATCGCTACTGAAGCAATAGAAAACTTCCGAACCGTTGTTTCTTTGACTCAGGAGCAGAAGTTTGAACATATGTATGCTCAGAGTTTGCAGGTACCATACAGAAACTCTTTGAGGAAAGCACACATCTTTGGAATTACATTTTCCTTCACCCAGGCAATGATGTA

Ensembl | human accession no.

ENSG00000085563

NCBI accession no.

NM_000927

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ABCB1(5243) , ABCB1(5243)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
KDV
ZAV
GZT
HQS
GOS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ho Kyung Seo et al.
The Prostate, 80(6), 453-462 (2020-03-07)
Docetaxel is the preferred chemotherapeutic agent for hormone-refractory prostate cancer (PC) patients. However, patients eventually develop docetaxel resistance, and no effective treatment options are available for them. We aimed to establish docetaxel resistance in castration-resistant prostate cancer (CRPC) cell lines
Vlasta Němcová-Fürstová et al.
Toxicology and applied pharmacology, 310, 215-228 (2016-09-25)
Development of taxane resistance has become clinically very important issue. The molecular mechanisms underlying the resistance are still unclear. To address this issue, we established paclitaxel-resistant sublines of the SK-BR-3 and MCF-7 breast cancer cell lines that are capable of
Michael Jelínek et al.
Toxicology and applied pharmacology, 347, 79-91 (2018-04-07)
We tested the role of substituents at the C3' and C3'N positions of the taxane molecule to identify taxane derivatives capable of overcoming acquired resistance to paclitaxel. Paclitaxel-resistant sublines SK-BR-3/PacR and MCF-7/PacR as well as the original paclitaxel-sensitive breast cancer
Xiaoqian Yang et al.
Pharmaceutical research, 32(6), 2097-2109 (2014-12-18)
Approaches for the synthesis of biomaterials to facilitate the delivery of "biologics" is a major area of research in cancer therapy. Here we designed and characterized a hyaluronic acid (HA) based self-assembling nanoparticles that can target CD44 receptors overexpressed on
Mitchell P McInerney et al.
Journal of pharmaceutical sciences, 106(9), 2614-2624 (2017-01-10)
An in-cell western (ICW) protocol detecting the relative expression of P-glycoprotein (P-gp) in human cerebro-microvascular endothelial cells (hCMEC/D3) was developed and optimized, with the intention of improving throughput relative to western blotting (WB). For validation of the ICW protocol, hCMEC/D3
Ver todos los artículos relacionados

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico