Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU130951

Sigma-Aldrich

MISSION® esiRNA

targeting human OVOL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTCCCAGTGGAGACCTGTTCACCTGCCGTGTCTGCCAGAAGGCCTTCACCTACCAGCGCATGCTGAACCGCCACATGAAGTGTCACAACGACGTCAAGAGGCACCTCTGCACGTACTGCGGGAAGGGCTTCAATGACACCTTCGACCTCAAGAGACACGTCCGAACTCACACTGGCGTGCGGCCCTACAAGTGCAGCCTGTGTGACAAGGCCTTCACGCAGCGCTGCTCTCTGGAGTCTCACCTCAAGAAGATCCATGGTGTGCAGCAGAAGTACGCGTACAAGGAGCGGCGGGCCAAGCTGTACGTGTGTGAGGAGTGCGGCTGCACATCTGAGAGCCAGGAGGGCCACGTCCTGCACCTGAAGGAGCACCACCCTGACAGCCCGCTGCTGCGCAAGACCTCCAAGAAGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Akiko Hashimoto-Hachiya et al.
International journal of molecular sciences, 19(6) (2018-06-06)
Rhodiola species are antioxidative, salubrious plants that are known to inhibit oxidative stress induced by ultraviolet and γ-radiation in epidermal keratinocytes. As certain phytochemicals activate aryl hydrocarbon receptors (AHR) or OVO-like 1 (OVOL1) to upregulate the expression of epidermal barrier
Maho Murata et al.
Journal of clinical medicine, 9(3) (2020-02-29)
Progression of actinic keratosis (AK) to cutaneous squamous cell carcinoma (cSCC) is rare. Most cases of AK remain as intraepidermal lesions, owing to the suppression of the epithelial-to-mesenchymal transition (EMT). Ovo-like transcriptional repressor 1 (OVOL1) and ovo-like zinc finger 2
Stephen J Renaud et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(45), E6175-E6184 (2015-10-28)
Epithelial barrier integrity is dependent on progenitor cells that either divide to replenish themselves or differentiate into a specialized epithelium. This paradigm exists in human placenta, where cytotrophoblast cells either propagate or undergo a unique differentiation program: fusion into an

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico