Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU129811

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCAACTGTCACACCACAACTACCACCTTATGGCGCAGAAACGCCGAGGGTGAACCCGTGTGCAATGCTTGTGGACTCTACATGAAACTCCATGGGGTGCCCAGACCACTTGCTATGAAAAAAGAGGGAATTCAAACCAGGAAACGAAAACCTAAGAACATAAATAAATCAAAGACTTGCTCTGGTAATAGCAATAATTCCATTCCCATGACTCCAACTTCCACCTCTTCTAACTCAGATGATTGCAGCAAAAATACTTCCCCCACAACACAACCTACAGCCTCAGGGGCGGGTGCCCCGGTGATGACTGGTGCGGGAGAGAGCACCAATCCCGAGAACAGCGAGCTCAAGTATTCGGGTCAAGATGGGCTCTACATAGGCGTCAGTCTCGCCTCGCCGGCCGAAGTCACGTCCTCCGTGCGACCGGATTCCTGGTGCGCCCTGGCCCTGGCCTGAGCCCACGCCGCCAGGAGGCAGGGAGGGCTCCGCCGCGGGCCTCACTCCACTCGTGTCTGCTTTTG

Ensembl | nº de acceso humano

ENSG00000141448

Nº de acceso NCBI

NM_005257

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GATA6(2627) , GATA6(2627)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
AFND
HQS
QCS
QAS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mao Guoping et al.
Oncology research, 26(7), 1023-1029 (2018-01-13)
Recent studies have suggested that the dysregulation of microRNAs (miRNAs) plays a critical role in the progression of human cancers, including gastric cancer (GC). miR-143 had been reported to function as a tumor suppressor in GC. However, the exact molecular
Ruishuang Ma et al.
Cancer biology & therapy, 20(9), 1206-1212 (2019-05-17)
Autophagy plays a complicated role in tumorigenesis, and the effects of autophagy in drug resistance have not been fully known. The aim of this study was to evaluate autophagy activity in lung cancer cells derived from different origins and explore
Chellappagounder Thangavel et al.
The American journal of pathology, 189(4), 847-867 (2019-02-02)
Caveolins (CAVs) are structural proteins of caveolae that function as signaling platforms to regulate smooth muscle contraction. Loss of CAV protein expression is associated with impaired contraction in obstruction-induced bladder smooth muscle (BSM) hypertrophy. In this study, microarray analysis of
Mio Nakanishi et al.
Cell, 177(4), 910-924 (2019-04-16)
The assembly of organized colonies is the earliest manifestation in the derivation or induction of pluripotency in vitro. However, the necessity and origin of this assemblance is unknown. Here, we identify human pluripotent founder cells (hPFCs) that initiate, as well as
Holly Brunton et al.
Cell reports, 31(6), 107625-107625 (2020-05-14)
Pancreatic ductal adenocarcinoma (PDAC) can be divided into transcriptomic subtypes with two broad lineages referred to as classical (pancreatic) and squamous. We find that these two subtypes are driven by distinct metabolic phenotypes. Loss of genes that drive endodermal lineage

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico