Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU129521

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL12

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAGCCAACGTCAAGCATCTCAAAATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAGCCCGGCTGAAGAACAACAACAGACAAGTGTGCATTGACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGAAAGCTTTAAACAAGTAAGCACAACAGCCAAAAAGGACTTTCCGCTAGACCCACTCGAGGAAAACTAAAACCTTGTGAGAGATGAAAGGGCAAAGACGTGGGGGAGGGGGCCTTAACCATGAGGACCAGGTGTGTGTGTGGGGTGGGCACATTGATCTGGGATCGGGCCTGAGGTTTGCCAGCATTTAGACCCTGCATTTATAGCATACGGTATGATATTGCAGCTTATATTCATCCATGCCCTGTACCTGTGCACGTTGGAACTTTTATTACTGGGGTTTTTCTAAGAAAGAAATTGTATTATCAACAGCATTTTCAAGCAGTTAGTTCCTTCATGATCATCACAATCATCATCATTCTCATTCTCATTTTTTAAATCAACGAGTACTTCAAGATCTGAATTTGGCTTGTTTGGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kangling Xie et al.
American journal of physiology. Cell physiology, 319(3), C579-C588 (2020-07-02)
Identification of specific biomarkers for ischemic stroke is necessary due to their abilities to improve treatment outcomes. Many studies have demonstrated the involvement of microRNAs (miRNAs) in the pathogenesis and complications of ischemic stroke and patient outcomes. We found that
Timo Rademakers et al.
Scientific reports, 7, 45263-45263 (2017-03-30)
During plaque progression, inflammatory cells progressively accumulate in the adventitia, paralleled by an increased presence of leaky vasa vasorum. We here show that next to vasa vasorum, also the adventitial lymphatic capillary bed is expanding during plaque development in humans
Guan-Xi Liu et al.
Brain, behavior, and immunity, 84, 72-79 (2019-11-22)
Conditioned place preference (CPP) is a learned behavior, in which animals learn to associate environmental contexts with rewarding effects. The formation of CPP is an integrated outcome of multiple learning processes. Although multiple anatomical substrates underlying this contextual learning have
Xiaoming Zhu et al.
Experimental cell research, 375(2), 41-50 (2019-01-07)
Cancer-associated fibroblasts (CAFs) play critical roles in tumor progression. However, the role and mechanism underlying CAFs in esophageal cancer (EC) remain unclear. In this study, primary CAFs and normal esophageal fibroblasts (NOFs) were isolated and characterized by immunofluorescence, qRT-PCR and
S J Han et al.
Cell death & disease, 6, e1863-e1863 (2015-08-28)
High-mobility group box 1 (HMGB1) functions as a transcription-enhancing nuclear protein as well as a crucial cytokine that regulates inflammation. This study demonstrated that secretion of HMGB1 due to ultraviolet (UV) radiation inducing ocular surface inflammation-mediated reactive oxygen species (ROS)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico