Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU129261

Sigma-Aldrich

MISSION® esiRNA

targeting human PAK6, BUB1B-PAK6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES
Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES
Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGCTGGACAGCTACGTGAAGATTGGCGAGGGCTCCACCGGCATCGTCTGCTTGGCCCGGGAGAAGCACTCGGGCCGCCAGGTGGCCGTCAAGATGATGGACCTCAGGAAGCAGCAGCGCAGGGAGCTGCTCTTCAACGAGGTGGTGATCATGCGGGACTACCAGCACTTCAACGTGGTGGAGATGTACAAGAGCTACCTGGTGGGCGAGGAGCTGTGGGTGCTCATGGAGTTCCTGCAGGGAGGAGCCCTCACAGACATCGTCTCCCAAGTCAGGCTGAATGAGGAGCAGATTGCCACTGTGTGTGAGGCTGTGCTGCAGGCCCTGGCCTACCTGCATGCTCAGGGTGTCATCCACCGGGACATCAAGAGTGACTCCATCCTGCTGACCCTCGATGGCAGGGTGAAGCTCTCGGACTTCGGATTCTGTGCTCAGATCAGCAAAGACGTCCCTAAGAGGAAGTCCCTGGTGGGAACCCCCTACTGGATGGCTCCTGAAGTGATCTCCAGGTCTTTGTATGCCACTGAGGTGGATATCTGGTCTCTGGGCATCATGGTGATTGAGATGGTAGATGGGGAGC

Ensembl | nº de acceso humano

ENSG00000137843

Nº de acceso NCBI

NM_001128628

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PAK6(106821730) , PAK6(56924)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JUU
NRR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Daniel Pensold et al.
Cerebral cortex (New York, N.Y. : 1991), 27(12), 5696-5714 (2017-11-09)
The proliferative niches in the subpallium generate a rich cellular variety fated for diverse telencephalic regions. The embryonic preoptic area (POA) represents one of these domains giving rise to the pool of cortical GABAergic interneurons and glial cells, in addition
Sally Fram et al.
Cellular and molecular life sciences : CMLS, 71(14), 2759-2773 (2013-12-20)
p-21 activated 6 (PAK6), first identified as interacting with the androgen receptor (AR), is over-expressed in multiple cancer tissues and has been linked to the progression of prostate cancer, however little is known about PAK6 function in the absence of
Jian Zhai et al.
Biochemical and biophysical research communications, 464(1), 161-167 (2015-06-28)
Emerging evidence suggests that microRNAs (miRNAs) play important roles in regulating HCC development and progression; however, the mechanisms by which their specific functions and mechanisms remained to be further explored. miR-129 has been reported in gastric cancers, lung cancer and
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of
Songwang Cai et al.
Oncotarget, 6(6), 3904-3917 (2015-02-26)
Here we found that levels of miR-23a were decreased in prostate cancer cell lines and tumor tissues. These low levels were associated with poor patients' prognosis. MiR-23a inhibited migration and invasion of prostate cancer in vivo and in orthotopic prostate

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico