Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU125691

Sigma-Aldrich

MISSION® esiRNA

targeting human FZD5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGGGGCTTTACAATCCTAAGGTTGGCGTTGTAATGAAGTTCCACTTGGTTCAGGTTTCTTTGAACTGTGTGGTCTCAATTGGGAAAATATATTTCCTATACGTGTGTCTTTAAAAAAAAATGTGAACAGTGAACGTTTCGGTTGCTGTGACTGGGAAGTTGTTGGGTGTGCTTTTTCAGCCAGCTTCTCCTTCCACTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaozhu Liu et al.
International journal of clinical and experimental pathology, 13(5), 889-895 (2020-06-09)
To explore the effects of miR-149 on the cell proliferation and apoptosis of colorectal cancer (CRC) and its potential molecular mechanism. miR-149 expression patterns were detected in human CRC cell lines by quantitative real-time RT-PCR (Q-PCR). Online prediction software and
Qing-Zhi Long et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 7017-7026 (2015-04-12)
Renal cell carcinoma (RCC) is one of most malignant neoplasms, exhibiting poor responsiveness to the conventional chemo-regime. Abnormal expression of P-glycoprotein (P-gp) has been implicated in the emergence of multiple-drug resistance (MDR) by reducing the accumulation of intracellular chemotherapy drugs.

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico