Todas las fotos(1)

Documentos clave

Certificado de origen (COO)/COA

EHU125631

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human FGFR2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Todas las fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descripción

Nivel de calidad

100

Línea del producto

MISSION^®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCAACACTGTCAAGTTTCGCTGCCCAGCCGGGGGGAACCCAATGCCAACCATGCGGTGGCTGAAAAACGGGAAGGAGTTTAAGCAGGAGCATCGCATTGGAGGCTACAAGGTACGAAACCAGCACTGGAGCCTCATTATGGAAAGTGTGGTCCCATCTGACAAGGGAAATTATACCTGTGTAGTGGAGAATGAATACGGGTCCATCAATCACACGTACCACCTGGATGTTGTGGAGCGATCGCCTCACCGGCCCATCCTCCAAGCCGGACTGCCGGCAAATGCCTCCACAGTGGTCGGAGGAGACGTAGA

Ensembl | nº de acceso humano

ENSG00000066468

Nº de acceso NCBI

NM_000141

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FGFR2(2263) , FGFR2(2263)

Categorías relacionadas

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

MicroRNA-889-3p targets FGFR2 to inhibit cervical cancer cell viability and invasion.

Yu Sun et al.

Experimental and therapeutic medicine, 18(2), 1440-1448 (2019-07-19)

MicroRNAs (miRNAs) are frequently dysregulated in cervical cancer, and the aberrant regulation of miRNAs may be involved in the regulation of various cancer-associated biological processes. Therefore, further exploration of the specific roles of dysregulated miRNAs in cervical cancer and their

Inhibition of fibroblast growth factor receptor-signaling sensitizes imatinib-resistant gastrointestinal stromal tumors to low doses of topoisomerase II inhibitors.

Sergei Boichuk et al.

Anti-cancer drugs, 29(6), 549-559 (2018-04-27)

The acquired resistance of gastrointestinal stromal tumors (GISTs) to the targeted-based therapy remains the driving force to identify the novel approaches that are capable of increasing the sensitivity of GISTs to the current therapeutic regimens. Our present data show that

Neuron and microglia/macrophage-derived FGF10 activate neuronal FGFR2/PI3K/Akt signaling and inhibit microglia/macrophages TLR4/NF-κB-dependent neuroinflammation to improve functional recovery after spinal cord injury.

Jian Chen et al.

Cell death & disease, 8(10), e3090-e3090 (2017-10-06)

Therapeutics used to treat central nervous system (CNS) injury were designed to repair neurites and inhibit cell apoptosis. Previous studies have shown that neuron-derived FGF10 exerts potential neuroprotective effects after cerebral ischemia injury. However, little is known about the role

Inhibition of FGFR2-Signaling Attenuates a Homology-Mediated DNA Repair in GIST and Sensitizes Them to DNA-Topoisomerase II Inhibitors.

Boichuk Sergei et al.

International journal of molecular sciences, 21(1) (2020-01-18)

Deregulation of receptor tyrosine kinase (RTK)-signaling is frequently observed in many human malignancies, making activated RTKs the promising therapeutic targets. In particular, activated RTK-signaling has a strong impact on tumor resistance to various DNA damaging agents, e.g., ionizing radiation and

Fibroblast growth factor receptor promotes progression of cutaneous squamous cell carcinoma.

Alok R Khandelwal et al.

Molecular carcinogenesis, 58(10), 1715-1725 (2019-06-30)

Cutaneous squamous cell carcinoma (cSCC) is a keratinocyte-derived invasive and metastatic tumor of the skin. It is the second-most commonly diagnosed form of skin cancer striking 200 000 Americans annually. Further, in organ transplant patients, there is a 65- to 100-fold

Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico