Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU125061

Sigma-Aldrich

MISSION® esiRNA

targeting human CALCA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES
Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES
Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCATGTGGTTTGGTTCCTCTCTGGTGGCTCTTTGGGCTGGTATTGGTGGCTTTCCTTGTGGCAGAGGATGTCTCAAACTTCAGATGGGAGGAAAGAGAGCAGGACTCACAGGTTGGAAGAGAATCACCTGGGAAAATACCAGAAAATGAGGGCCGCTTTGAGTCCCCCAGAGATGTCATCAGAGCTCCTCTGTCCTGCTTCTGAATGTGC

Ensembl | nº de acceso humano

ENSG00000110680

Nº de acceso NCBI

NM_001033952

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CALCA(796) , CALCA(796)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yin-Hung Chu et al.
Cells, 9(3) (2020-03-19)
Epithelial-mesenchymal transition (EMT) is strongly correlated with tumor metastasis and contains several protein markers, such as E-cadherin. Carbonic anhydrase III (CA III) exhibits low carbon dioxide hydratase activity in cancer. However, the detailed mechanisms of CA III and their roles
Yanjun Guo et al.
Peptides, 121, 170121-170121 (2019-08-07)
Endothelial dysfunction is considered to be an initial indicator in diabetes-induced macrovascular complications. Evidence has shown that CGRP is an important neuropeptide active in vascular system, especially in vasorelaxation. This study aimed to investigate the role of CGRP in high-glucose-induced
Ines Block et al.
Oncogene, 38(23), 4560-4573 (2019-02-14)
Breast cancer is a heterogeneous genetic disease driven by the accumulation of individual mutations per tumor. Whole-genome sequencing approaches have identified numerous genes with recurrent mutations in primary tumors. Although mutations in well characterized tumor suppressors and oncogenes are overrepresented
Richard A Byrd et al.
Endocrinology, 156(7), 2417-2428 (2015-04-11)
The tumorigenic potential of dulaglutide was evaluated in rats and transgenic mice. Rats were injected sc twice weekly for 93 weeks with dulaglutide 0, 0.05, 0.5, 1.5, or 5 mg/kg corresponding to 0, 0.5, 7, 20, and 58 times, respectively
John L Vahle et al.
Endocrinology, 156(7), 2409-2416 (2015-04-11)
Glucagon-like peptide-1 (GLP-1) receptor agonists, used for the treatment of type 2 diabetes, have caused hyperplasia/neoplasia of thyroid C cells in rodent carcinogenicity studies. Studies in monkeys have not identified an effect of GLP-1 receptor agonists on thyroid C cells;
Ver todos los artículos relacionados

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico