Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU116291

Sigma-Aldrich

MISSION® esiRNA

targeting human LGALS9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTGCTCAGAGGTTCCACATCAACCTGTGCTCTGGGAACCACATCGCCTTCCACCTGAACCCCCGTTTTGATGAGAATGCTGTGGTCCGCAACACCCAGATCGACAACTCCTGGGGGTCTGAGGAGCGAAGTCTGCCCCGAAAAATGCCCTTCGTCCGTGGCCAGAGCTTCTCAGTGTGGATCTTGTGTGAAGCTCACTGCCTCAAGGTGGCCGTGGATGGTCAGCACCTGTTTGAATACTACCATCGCCTGAGGAACCTGCCCACCATCAACAGACTGGAAGTGGGGGGCGACATCCAGCTGACCCATGTGCAGACATAGGCGGCTTCCTGGCCCTGGGGCCGGGGGCTGGGGTGTGGGGCAGTCTGGGTCCTCTCATCATCC

Ensembl | human accession no.

ENSG00000168961

NCBI accession no.

NM_002308

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LGALS9(3965) , LGALS9(3965)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Katrin Schaefer et al.
Glycobiology, 27(9), 878-887 (2017-08-16)
Changes in the T cell surface redox environment regulate critical cell functions, such as cell migration, viral entry and cytokine production. Cell surface protein disulfide isomerase (PDI) contributes to the regulation of T cell surface redox status. Cell surface PDI
Akira Nishio et al.
Hepatology (Baltimore, Md.), 65(1), 18-31 (2016-09-20)
Natural killer (NK) cell activation is associated with both liver injury and persistent infection in chronic hepatitis C (CHC); however, the detailed mechanism of this activation has not yet been fully elucidated. Because galectin-9 (Gal-9) has been reported to be
Ran Lv et al.
Molecular medicine reports, 16(6), 9111-9119 (2017-10-11)
Generally considered as a potent pro‑inflammatory signal, β‑galactosidelectin suppresses T cell receptor activation, can both promote and inhibit integrin‑mediated adhesion and is required in nuclear pre‑mRNA splicing. Galectin‑9 (Gal‑9), a member of β‑galactoside lectin, is involved many processes of T cell‑mediated
Tomokazu Nunoue et al.
Scientific reports, 11(1), 5991-5991 (2021-03-18)
The adipose tissue is regarded as an endocrine organ and secretes bioactive adipokines modulating chronic inflammation and oxidative stress in obesity. Gal-9 is secreted out upon cell injuries, interacts with T-cell immunoglobulin-3 (Tim-3) and induces apoptosis in activated Th1 cells.
Wenxi Zhou et al.
Biomaterials, 268, 120546-120546 (2020-12-01)
Immunotherapy has gained increasing focus in treating pancreatic ductal adenocarcinoma (PDAC), since conventional therapies like chemotherapy could not provide satisfactory improvement in overall survival outcome of PDAC patients. However, it is still not the game changing solution due to the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico