Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU114181

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDX3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGATTTCACCTTTGTGTGTCCTACAGAAATTGTTGCTTTTAGTGACAAAGCTAACGAATTTCACGACGTGAACTGTGAAGTTGTCGCAGTCTCAGTGGATTCCCACTTTAGCCATCTTGCCTGGATAAATACACCAAGAAAGAATGGTGGTTTGGGCCACATGAACATCGCACTCTTGTCAGACTTAACTAAGCAGATTTCCCGAGACTACGGTGTGCTGTTAGAAGGTTCTGGTCTTGCACTAAGAGGTCTCTTCATAATTGACCCCAATGGAGTCATCAAGCATTTGAGCGTCAACGATCTCCCAGTGGGCCGAAGCGTGGAAGAAACCCTCCGCTTGGTGAAGGCGTTCCAGTATGTAGAAACACATGGAGAAGTCTGCCCAGCGAACTGGACACCGGATTCTCCTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

Storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Min-Yao Jiang et al.
Oncotarget, 8(46), 80295-80302 (2017-11-09)
Benign prostatic hyperplasia (BPH) is one of the most common diseases in the senior men and age plays an important role in the initiation and development of BPH. Mammalian cells primarily use the autophagy-lysosome system to degrade misfolded/aggregated proteins and
Hua Zhang et al.
Oncotarget, 8(2), 3471-3480 (2016-12-15)
Peroxiredoxin (PRDX) proteins are involved in carcinogenesis. PRDX3, which is predominantly localized in mitochondria and up-regulated in several human cancers, seems to confer increased treatment resistance and aggressive phenotypes. This study examined the expression profile of PRDX3 and its possible
Inah Hwang et al.
Free radical biology & medicine, 131, 162-172 (2018-12-12)
Chronic kidney disease (CKD) has become epidemic worldwide. Mitochondrial reactive oxygen species (ROS)-induced oxidative stress is an important mediator of CKD, and Prx3 plays a critical role in maintenance of mitochondrial ROS. The present study examined the role of Prx3
Brian Cunniff et al.
PloS one, 10(5), e0127310-e0127310 (2015-05-27)
Dysregulation of signaling pathways and energy metabolism in cancer cells enhances production of mitochondrial hydrogen peroxide that supports tumorigenesis through multiple mechanisms. To counteract the adverse effects of mitochondrial peroxide many solid tumor types up-regulate the mitochondrial thioredoxin reductase 2--thioredoxin

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico