Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU113851

Sigma-Aldrich

MISSION® esiRNA

targeting human PABPC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTCCTAAATGATCGCAAAGTATTTGTTGGACGATTTAAGTCTCGTAAAGAACGAGAAGCTGAACTTGGAGCTAGGGCAAAAGAATTCACCAATGTTTACATCAAGAATTTTGGAGAAGACATGGATGATGAGCGCCTTAAGGATCTCTTTGGCAAGTTTGGGCCTGCCTTAAGTGTGAAAGTAATGACTGATGAAAGTGGAAAATCCAAAGGATTTGGATTTGTAAGCTTTGAAAGGCATGAAGATGCACAGAAAGCTGTGGATGAGATGAACGGAAAGGAGCTCAATGGAAAACAAATTTATGTTGGTCGAGCTCAGAAAAAGGTGGAACGGCAGACGGAACTTAAGCGCAAATTTGAACAGATGAAACAAGATAGGATCACCAGATACCAGGGTGTTAATCTTTATGTGAAAAATCTTGATGATGGTATTGATGATGAACGTCTCCGGAAAGAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qiao Xue et al.
Pathogens (Basel, Switzerland), 9(6) (2020-06-10)
Seneca Valley Virus (SVV) is an oncolytic virus of the Picornaviridae family, which has emerged in recent years. The impact of SVV on host cell translation remains unknown. Here, we showed, for the first time, that SVV infection cleaved poly(A)
Xia Jiang et al.
PloS one, 9(7), e101993-e101993 (2014-07-08)
Despite the development and availability of hepatitis A virus (HAV) vaccine, HAV infection is still a major cause of acute hepatitis that occasionally leads to fatal liver disease. HAV internal ribosomal entry-site (IRES) is one of the attractive targets of
Nicola Guzzi et al.
Cell, 173(5), 1204-1216 (2018-04-10)
Pseudouridylation (Ψ) is the most abundant and widespread type of RNA epigenetic modification in living organisms; however, the biological role of Ψ remains poorly understood. Here, we show that a Ψ-driven posttranscriptional program steers translation control to impact stem cell commitment during

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico